Notice Event & Winner list Clients' Publications Order Guideline Sample Submission Result Download How to Pay Troubleshooting Guide Universal Primer Mileage Usage Guide FAQ Project Quotation Contact Us

Page Size 10 30 50 If I have any trouble with payment, how to solve it? Please contact to payment@macrogen.com Which credit cards do you accept? We accept Visa, Master Card, or American Express Card. How do I pay for my order? Once, sequencing order has been finalised the accorded invoice will be issued. Then you can choose any available payment option(Credit Card/Wire Transfer/Cheque). More information on payment can be found from below address: http://dna.macrogen.com/eng/help/howtopay.jsp Sample / primer return Macrogen does not send back DNA sample or primer to customers. Due to difficult customs clearance in some countries, Macrogen Korea cannot sometimes send out biological products. If you have to get them back, please check below things first: 1. custom clearance in your countries and required document 2. Fedex account number of yours so that we can send as recipient's payment Free Shipping to Macrogen Inc. (Korea) or Macrogen Europe (The Netherlands) Macrogen Inc.(Korea) pay shipping fee for more than 20 reactions's order. Our account number of Fedex(preferred), DHL or TNT should clearly be written and it should be checked as reciever's payment on the airway bill. We are not responsible for paying wrongly charged invoice. It is room temperature packing only and should be less than 1kg. (Not in a big box.) If you want to pack your samples with dry ice/ice pack, shipping fee is not covered by Macrogen Inc.(Korea). **Free shipping for European express sequencing service is also applied, so please contact Macrogen Europe at europe@macrogen.com. Retrial(Re-sequencing) Request Terms&Condition If you are not satisfied with the previous sequencing reactions, you can request re-trial. We will check DNA condition and primer to make a better result in the retrial. (This resequencing service is not provided for any kind of plate discount order.) The sample and primer should have the same match and both sample and primer should be available here in Macrogen. If you have to send more sample or primer, it is not regarded as a free retrial order. It will be regarded as a paid new order. Re-sequencing request is only available for one month from the notice date of sample arrival. Glycerol Concentration I need to know how should I send my cells for sequencing. What percentage of Glycerol should I use in the samples. => 1:1 mix up with 30% glycerol stock to make 15% of final glycerol concentration would be fine. Log in Problem If you fails to log in even with correct ID and password, it could be cookie problems. If browser version is 6.0, you may need to change your computer's cookies settings as described below. 1) On the Tools, select 'Internet Options'. 2) Remove cookies and all off-line files from "Delete Cookies." 3) Then, go to the "Privacy Tab" and set it "Advanced." 4) Select "Override automatic cookies handling" and "Always allow session cookies". These two options must be checked, as well as "First_Party Cookie_Accept". 5) Select "Privacy" and click "Edit". 6) Address of website "dna.macrogen.com" and select "Allow." 7) Click "OK" and shut all the exploer windows. 8) Try log in with a new explorer window. Do you synthesize primers? We do synthesize primers as long as they are used in sequencing by us. It means, we don't sell primers themselves. It is charged per mer. You may design primer and give us primer sequences as you want. Primer synthesis is currently available only in Korea(Macrogen Inc.). **For European express service(by Macrogen Europe, Netherlands), primer synthesis service will be available soon. Will you keep my samples? We can keep leftover of DNA and primers for one month ~ three months upon receipt. If you want to sequence among them, please place an order from "Additional Order" menu. Or, you may just give us a comment when and from whom samples were delivered here with sequencing information. Concentration of Primer 20ul with concentration of 10pmole can cover 5 reactions. Please increase 10pmole each time the number of reactions is increasing. We recommend the quality of HPLC or PAGE purified primers for sequencing reactions, but OPC is o.k as long as it can guarantee the equivalent quality. About 17-25 mer, 40~60% of GC content and less than 4bp of dimer formation or hair-pin formation are recommended to guarantee high end stability. Tm is required about 50~58, because annealing temperature is fixed at 50 . Primer concentration should be known before sequencing reactions. May I place an order in Maryland Branch? You may also use our Maryland branch's facility. It has the same quality of sequencing skills. But it is independent from Seoul, Korea office and the price is little bit different from Korea headquarter's. You may contact US branch and get more information. 9700 Great Seneca Hwy Rockville MD 20850 USA Tel : 301-251-1007 Fax : 301-251-4006 customer@macrogenusa.com Is there minimum number of samples in sequencing order? No, there is no such minimum number or maximum number of sequencing reactions. Just we recommend you send DNAs for at least 20 sequencing reactions to save your shipping fee. What is 96 / 384 well plate sequencing? If you order in 96 or 384 well plate, you may have choose either of the plate sequencing order with discount. 1. "Plate Sequencing" refers to the orders charged per plate. To use this order, your samples should meet all of the following criteria. - Samples are sent to Macrogen pre-arranged in 96-well plates. (No 384 plate service is available) - Only two custom primers (or two universal primers) in tubes could be acceptable for applying this Plate sequencing. * Note: - For three or more primers, another paired primer plate with your sample plate should be provided. if not, your order will be regarded as Normal sequencing reactions. - The well to well variation of the concentration of your samples is very important to get better results, please keep it as constant as possible. 2. "1 Primer / 1 Plate" refers to the orders charged per plate. To use this order, your samples should meet all of the following criteria. - Samples are sent to Macrogen pre-arranged in 96-well or 384-well plates. - Only one single primer should be applied to the whole plate,so that we Macrogen can simply put the primers to the corresponding sample plate. - More economical than Plate sequencing service. - No sample name is required, but plate name is enough for this service. We will provide the results as the following file name. And please be aware that there is no free resequencing service in either of above discounted sequencing order. If rerun is required, it will be regarded as a new order of regular reaction. Do I need to use on-line system all the time? On-line system is made for the ease and accuracy of order, so we recommend you to use the system. It is much more convenient because you will be able to order online and retrieve the result online as well as leave a message in no time. What is the average read length? We read approximately ~850bp per reaction, and 650bp of them has Phred 20 or higher quality. What kind of machines you use? We use ABI3730XL What kind of computer system is required for on-line system? The system is designed to be compatible with all of the systems including PC, Mac, and many other conventional operating system. Universal primers available in Macrogen We have the following primers available at no extra charge. Primer Name Sequence Base T7 AATACGACTCACTATAG 17 T7terminator GCTAGTTATTGCTCAGCGG 19 T7promoter TAATACGACTCACTATAGGG 20 T3 ATTAACCCTCACTAAAG 17 SP6 ATTTAGGTGACACTATAG 18 M13F-pUC(-40) GTTTTCCCAGTCACGAC 17 M13R-pUC(-40) CAGGAAACAGCTATGAC 17 M13F(-20) GTAAAACGACGGCCAGT 17 M13R(-20) GCGGATAACAATTTCACACAGG 22 pGEX5 GGCAAGCCACGTTTGGTG 18 pGEX3 GGAGCTGCATGTGTCAGAGG 20 27F AGAGTTTGATCMTGGCTCAG 20 1492R TACGGYTACCTTGTTACGACTT 22 518F CCAGCAGCCGCGGTAATACG 20 800R TACCAGGGTATCTAATCC 18 BGH-R TAGAAGGCACAGTCGAGG 18 CMV-F CGCAAATGGGCGGTAGGCGTG 21 RVprimer3 CTAGCAAAATAGGCTGTCCC 20 RVprimer4 GACGATAGTCATGCCCCGCG 20 GLprimer1 TGTATCTTATGGTACTGTAACTG 23 GLprimer2 CTTTATGTTTTTGGCGTCTTCCA 23 pQE-F CCCGAAAAGTGCCACCTG 18 pQE-R GTTCTGAGGTCATTACTGG 19 Gal4AD TACCACTACAATGGATG 17 pBAD-F ATGCCATAGCATTTTTATCCA 21 pBAD-R GATTTAATCTGTATCAGG 18 EGFP-CF AGCACCCAGTCCGCCCTGAGC 21 EGFP-CR CGTCCATGCCGAGAGTG 17 EGFP-NR CGTCGCCGTCCAGCTC 16 Bluescript SK CGCTCTAGAACTAGTGGATC 20 EBV-RP GTGGTTTGTCCAAACTCATC 20 KAN2-FP ACCTACAACAAAGCTCTCATCAACC 25 KAN2-RP GCAATGTAACATCAGAGATTTTGAG 25 M13-FP TGTAAAACGACGGCCAGT 18 pBacPAC-RP GTCTGTAAATCAACAACGC 19 pBAD-FP ATGCCATAGCATTTTTATCC 20 pDONOR-FP TAACGCTAGCATGGATCTC 19 pEGFP_N CCGTCCAGCTCGACCAG 17 pEGFP-FP TTTAGTGAACCGTCAGATC 19 pEGFP-RP AACAGCTCCTCGCCCTTG 18 pESP-RP TCCAAAAGAAGTCGAGTGG 19 pET-24a GGGTTATGCTAGTTATTGCTCAG 23 pET-RP CTAGTTATTGCTCAGCGG 18 pMalE TCAGACTGTCGATGAAGC 18 pREP-fwd_primer GCTCGATACAATAAACGCC 19 35S-A AAGGGTCTTGCGAAGGATAG 20 35S-B AGTGGAAAAGGAAGGTGGCT 20 AD Reverse AGATGGTGCACGATGCACAG 20 CYC1 Reverse GCGTGAATGTAAGCGTGAC 19 DsRed1-C AGCTGGACATCACCTCCCACAACG 24 DsRed1-N GTACTGGAACTGGGGGGACAG 21 EGFP-C CATGGTCCTGCTGGAGTTCGTG 22 EGFP-N CGTCGCCGTCCAGCTCGACCAG 22 GAL1 Forward AATATACCTCTATACTTTAACGTC 24 U-19mer Primer GTTTTCCCAGTCACGACGT 19 T7 EEV ATGTCGTAATAACCCCGCCCCG 22 Bluescript KS TCGAGGTCGACGGTATC 17 pFastBac Forward GGATTATTCATACCGTCCCA 20 pFastBac Reverse CAAATGTGGTATGGCTGATT 20 AOX1 Forward GACTGGTTCCAATTGACAAGC 21 AOX1 Reverse GCAAATGGCATTCTGACATCC 21 a-Factor TACTATTGCCAGCATTGCTGC 21 STag 18mer Primer GAACGCCAGCACATGGAC 18 MT Forward CATCTCAGTGCAACTAAA 18 QE Promoter CCGAAAAGTGCCACCTG 17 pRH Forward CTGTCTCTATACTCCCCTATAG 22 pRH Reverse CAAAATTCAATAGTTACTATCGC 23 SV40-pArev CCTCTACAAATGTGGTATGG 20 SV40-Promoter GCCCCTAACTCCGCCCATCC 20 pTrcHis Forward GAGGTATATATTAATGTATCG 21 ITS1 TCCGTAGGTGAACCTGCGG 19 ITS2 GCTGCGTTCTTCATCGATGC 20 ITS3 GCATCGATGAAGAACGCAGC 20 ITS4 TCCTCCGCTTATTGATATGC 20 pJET1.2R AAGAACATCGATTTTCCATGGCAG 24 What are your preferred methods of purification? We do not have any special preference for purification kit. Conventional column-type purification is good as well as the Exo-SAP purification. Is failed one sequenced again automatically? No. Please give us the list of samples to be resequenced, and we will perform sequencing again if they are failed ones. http://wgs2.macrogen.com/~link/order-sheet-retrial.xls Or you may place a resequencing order from "Repeat" menu. Resequencing is free only with the sample DNA and primer match. Note : Free retrial is Not available for Plate sequencing service and 1primer/1plate service. How much is it to run the samples with unsatisfactory results again? Retrial for failed ones are provided for free for once. It is free only when samples and primers left sufficiently and it should be the same DNA and primer match from the first trial. Note : Free retrial is Not available for Plate sequencing service and 1primer/1plate service. Only a partial number of samples were processed. We assign all the samples in 384-well plates and proceed with our machines, and in some cases, your samples can be divided in two different plates. If this happens, you will be receiving the results in two different batches. Also, if you've requested samples for PCR prufication along with samples for ready-to-sequence, they can be divided and sent separetely. We will be giving all the results in the end, and if you don't receive the other part of the results within one week, please contact us immedaitely. How long does it take to get my results back? Within 48 hours from the date of sample arrival, the results shall be sent to you. It may take 3~4 more days in case of primer synthesis, PCR, or purification. I cannot unzip the result file. If you are using MAC, not PC, we can provide *.sit compressed file as well. Please request us for this. I haven't received my results yet. We generally send the results with 48 hours from the date of samples reception, and if you haven't received the results by then, please contact us immediately. I cannot open AB1 files. Our AB1 files can be opened by conventional softwares such as BioEdit, Chromas, Finch TV, Vector NTI, and so many applications. For those customers without these softwares, we provide Acrobat PDF files as well. How long the results are stored in your web page? The results are stored for three months, after then results will be discarded. We recommend you to download the results in your secure location as soon as they become available in the web. How can I order online? You may place an order from "Make an Order" menu of our on-line ordering system. Below address will help you to understand how to order online. http://dna.macrogen.com/eng/help/orderg.jsp I haven't received the arrival notice yet. What happened? Arrival notice is usually sent a little bit later when all the samples are properly arranged. But if you haven't received our arrival notice for one week, please contact us immediately with the Fedex tracking number. Probably there would be a problem in unidentified sender and orderer. How long are my samples kept in freezer of Macrogen? Basically we keep them for one month, and on special request, we extend this to be three months. Should I send the primers along with the tempate DNA? We recommend the primers to be sent in separate tubes with template DNA so that we can adjust the amount of primer. Could you please advise when samples will be picked up? We currently provide sample-pickup service in a couple of region in the world, and please contact us for the pickup in your location. Usually, our representative visit your lab on designated day to pick up your samples. Currently Available Institution : University of British Columbia (Canada): Friday Simon Fraser University(Canada): Friday Melbourne University(Australia): Friday Kasetsart University/Chulalongkorn University/Mahidol University(Thailiand): Friday Buenos Aires(Argentina): Friday University of Copenhagen(Denmark): Tuesday, Thursday Hvidovre Hospital/Statens Serum Institute(Denmark): Thursday We are going to expand this pickup service in near future. Do you have discounts for samples with large in number? Yes. Please contact us for quotation for large scale sequencing projects. Generally, 3,000 reactions at a time or 20,000 reactions a year could be negotiated. Concentration of plasmid / PCR product Minimum 20ul of 100ng/ul(plasmids, unpurified PCR products) or 50ng/ul(purified PCR products) are required for a couple of reactions. Do I need to put dry ice or any chilling material in the parcel? Dry ice is NOT required. It is dangerous goods in customs clearance and it will take longer time to deliver. And we will not pay for shipping for package with dry ice. Fedex is not available in my location. How can I send the samples? We recommend Fedex most. But in some places, it may not be an easy choice. You can use TNT or DHL. Please contact us(info@macrogen.com or europe@macrogen.com) for trying other courier service. How many samples should I send to be eligible for the free shipping by Fedex? More than 20 reactions(or equivalent number of samples) shall be eligible for free shipping to Macrogen Inc.(Korea) or Macrogen Europe (The Netherlands). You may refer our account number and check the bill as recipient's payment. You may collect your colleagues' samples to make up 20 or more reactions and save your shipping fee. We never reimburse the shipping fee but you should check the bill as recipient's payment. Shipment Address Shipping address for Value sequencing service is : Macrogen Inc. #908 World Meridian Center 60-24, Gasan-dong, Geumchun-gu, Seoul, Korea, 153-781 Shipping address for European express sequencing service is : Macrogen Europe IWO, Kamer IA3-195, Meibergdreef 39 1105 AZ Amsterdam Zuid-oost Netherlands   1

Copyright 2005-2009 (C) Macrogen Inc. All rights reserved. 908 World Meridian Venture Center, #60-24, Gasan-dong, Geumchun-gu, Seoul 153-781, Korea We recommend resolution of 1024x768 or higher, and Internet explorer of v6.0 or more advanced version for the proper display of this web site.