Universal Primer

 

»  News
»  Event
»  Conferences &
    Seminars
»  Client's Publication
»  Mileage usage guide
»  Contact us
»  FAQ
»  Download
»  Technical Newsletter
»  Mobile Applications
Universal Primer
Primer Name Sequence Base
Bluescript SK CGCTCTAGAACTAGTGGATC 20
EBV-RP GTGGTTTGTCCAAACTCATC 20
KAN2-FP ACCTACAACAAAGCTCTCATCAACC 25
KAN2-RP GCAATGTAACATCAGAGATTTTGAG 25
M13-FP TGTAAAACGACGGCCAGT 18
pBacPAC-RP GTCTGTAAATCAACAACGC 19
pBAD-FP ATGCCATAGCATTTTTATCC 20
pDONOR-FP TAACGCTAGCATGGATCTC 19
pEGFP_N CCGTCCAGCTCGACCAG 17
pEGFP-FP TTTAGTGAACCGTCAGATC 19
pEGFP-RP AACAGCTCCTCGCCCTTG 18
pESP-RP TCCAAAAGAAGTCGAGTGG 19
pET-24a GGGTTATGCTAGTTATTGCTCAG 23
pET-RP CTAGTTATTGCTCAGCGG 18
pMalE TCAGACTGTCGATGAAGC 18
pREP-fwd GCTCGATACAATAAACGCC 19
35S-A AAGGGTCTTGCGAAGGATAG 20
35S-B AGTGGAAAAGGAAGGTGGCT 20
AD Reverse AGATGGTGCACGATGCACAG 20
CYC1 Reverse GCGTGAATGTAAGCGTGAC 19
DsRed1-C AGCTGGACATCACCTCCCACAACG 24
DsRed1-N GTACTGGAACTGGGGGGACAG 21
EGFP-C CATGGTCCTGCTGGAGTTCGTG 22
EGFP-N CGTCGCCGTCCAGCTCGACCAG 22
GAL1 Forward AATATACCTCTATACTTTAACGTC 24
U-19mer Primer GTTTTCCCAGTCACGACGT 19
T7 EEV ATGTCGTAATAACCCCGCCCCG 22
Bluescript KS TCGAGGTCGACGGTATC 17
pFastBac Forward GGATTATTCATACCGTCCCA 20
pFastBac Reverse CAAATGTGGTATGGCTGATT 20
AOX1 Forward GACTGGTTCCAATTGACAAGC 21
AOX1 Reverse GCAAATGGCATTCTGACATCC 21
a-Factor TACTATTGCCAGCATTGCTGC 21
STag 18mer Primer GAACGCCAGCACATGGAC 18
MT Forward CATCTCAGTGCAACTAAA 18
QE Promoter CCGAAAAGTGCCACCTG 17
pRH Forward CTGTCTCTATACTCCCCTATAG 22
pRH Reverse CAAAATTCAATAGTTACTATCGC 23
SV40-pArev CCTCTACAAATGTGGTATGG 20
SV40-Promoter GCCCCTAACTCCGCCCATCC 20
pTrcHis Forward GAGGTATATATTAATGTATCG 21
ITS1 TCCGTAGGTGAACCTGCGG 19
ITS2 GCTGCGTTCTTCATCGATGC 20
ITS3 GCATCGATGAAGAACGCAGC 20
ITS4 TCCTCCGCTTATTGATATGC 20
ITS5 GGAAGTAAAAGTCGTAACAAGG 22
pJET1.2F CGACTCACTATAGGGAGAGCGGC 23
pJET1.2R AAGAACATCGATTTTCCATGGCAG 24
T7 AATACGACTCACTATAG 17
T7terminator GCTAGTTATTGCTCAGCGG 19
T7promoter TAATACGACTCACTATAGGG 20
T3 ATTAACCCTCACTAAAG 17
SP6 ATTTAGGTGACACTATAG 18
M13F-pUC(-40) GTTTTCCCAGTCACGAC 17
M13R-pUC(-40) CAGGAAACAGCTATGAC 17
M13F GTAAAACGACGGCCAGT 17
M13R GCGGATAACAATTTCACACAGG 22
pGEX5 GGCAAGCCACGTTTGGTG 18
pGEX3 GGAGCTGCATGTGTCAGAGG 20
27F AGAGTTTGATCMTGGCTCAG 20
1492R TACGGYTACCTTGTTACGACTT 22
518F CCAGCAGCCGCGGTAATACG 20
800R TACCAGGGTATCTAATCC 18
BGH-R TAGAAGGCACAGTCGAGG 18
CMV-F CGCAAATGGGCGGTAGGCGTG 21
RVprimer3 CTAGCAAAATAGGCTGTCCC 20
RVprimer4 GACGATAGTCATGCCCCGCG 20
GLprimer1 TGTATCTTATGGTACTGTAACTG 23
GLprimer2 CTTTATGTTTTTGGCGTCTTCCA 23
pQE-F CCCGAAAAGTGCCACCTG 18
pQE-R GTTCTGAGGTCATTACTGG 19
Gal4AD TACCACTACAATGGATG 17
pBAD-F ATGCCATAGCATTTTTATCCA 21
pBAD-R GATTTAATCTGTATCAGG 18
EGFP-CF AGCACCCAGTCCGCCCTGAGC 21
EGFP-CR CGTCCATGCCGAGAGTG 17
EGFP-NR CGTCGCCGTCCAGCTC 16
LCO1490 GGTCAACAAATCATAAAGATATTGG 25
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA 26
785F GGATTAGATACCCTGGTA 18
907R CCGTCAATTCMTTTRAGTTT 20
337F GACTCCTACGGGAGGCWGCAG 21
1100R GGGTTGCGCTCGTTG 15
NS1 GTAGTCATATGCTTGTCTC 19
NS8 TCCGCAGGTTCACCTACGGA 20
LR0R ACCCGCTGAACTTAAGC 17
LR7 TACTACCACCAAGATCT 17