Cloning Region
GTTTTCCCAGTCACGACGCTGTAAAACGACGGCCAGTGAATTACTTGAAGGTACTTCTCTAATACATCTTGAAATCGGGTCCC/GGGCTCTACGAGAGCACAGTCCGGCGTGCAGAGATGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGC
Sequencing Primer
| M13F-pUC | GTTTTCCCAGTCACGAC |
| M13R | GCGGATAACAATTTCACACAGG |
The purpose of the Terms is to establish the rights and obligations of Macrogen and Client with respect to Macrogen's service or product as requested or ordered by Client. Macrogen and Client shall faithfully perform their duties as specified in these Terms.
Unless specified otherwise in these Terms, the following terms have the meanings set forth herein.
These Terms shall become effective as of the date when Client places an order and shall remain in full force and effect till the completion date unless agreed otherwise.
| Service name | Analysis sample | Data |
|---|---|---|
| CES | 90 calendar days | 3 years |
| Oligo | N/A | 3 years |
| NGS | 90 calendar days | 30 calendar days |
| Clinical | 90 calendar days | 90 calendar days |
| Chip | 90 calendar days | 90 calendar days |
After placing an order, Client may request and receive additional technical support or consulting service from Macrogen. In the event that such support or service incur any additional costs, Macrogen shall notify and discuss with the client in advance.
본 약관의 적용을 위한 용어는 다른 특별한 언급이 없는 한 다음 각 호의 의미로 사용된다.
본 약관의 유효기간은 별도로 양 당사자의 서면합의에 의한 변경이 없는 한 주문 등록일로부터 서비스 또는 제품 제공과 대금지급을 포함한 본 약관에 따른 모든 이행사항이 완료되는 시점까지로 한다.
주문자 또는 마크로젠이 본 약관에서 정한 사항을 위반하여 상대방에게 손해를 입힌 경우에는 귀책사유가 있는 당사자는 상대방의 손해를 배상하여야 한다. 다만, 주문자에게 부담하는 마크로젠의 손해배상 범위는 관련 주문건에 해당하는 대금의 총액을 초과할 수 없다.
주문 후 주문자는 마크로젠에 추가적인 기술 지원 또는 자문을 요청 할 수 있으며, 이에 따른 별도 비용이 발생하는 경우에는 마크로젠은 사전에 이를 주문자에게 안내하고 주문자와 관련사항을 협의하여야 한다.
각 당사자는 상대방의 사전 서면동의 없이 본 약관상의 지위, 권리 또는 의무의 전부 또는 일부를 임의로 제 3자에게 양도, 담보제공 또는 대여 등 일체의 처분행위를 할 수 없다.
Como usar Pick-Up servicio con GRATIS en Santiago?
How to use Pick-Up service for free in Santiago?
Tienes pregunta?
Contacto +56 9 5845 1395
Envianos tus muestras de forma segura a Chile
The safest way to deliver your sample to Chile?
Tienes pregunta?
Contacto +56 9 5845 1395