Insert title here

pMG-Amp Map

Cloning Region

GTTTTCCCAGTCACGACGCTGTAAAACGACGGCCAGTGAATTACTTGAAGGTACTTCTCTAATACATCTTGAAATCGGGTCCC/GGGCTCTACGAGAGCACAGTCCGGCGTGCAGAGATGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGC

Sequencing Primer

M13F-pUC GTTTTCCCAGTCACGAC
M13R GCGGATAACAATTTCACACAGG
Close

Find

Close

change password

Current password
New password
Confirm new password
Close

Batch Change툴팁
You can change the selected amount and purification at once.

Amount*
Purification*
Close

Make a new group

Normal Barcode

Close

Terms of Order

Macrogen, Inc. provides service or product in accordance with the following terms and conditions (the "Terms") at the client's request.

1. Purpose

The purpose of the Terms is to establish the rights and obligations of Macrogen and Client with respect to Macrogen's service or product as requested or ordered by Client. Macrogen and Client shall faithfully perform their duties as specified in these Terms.

2. Definition

Unless specified otherwise in these Terms, the following terms have the meanings set forth herein.

  1. "Client" is a company or a person who orders service or product, and "Macrogen" is the provider of the service or product to Client.
  2. "Result" means the result of an analysis ordered by Client.
  3. "Product" means goods that Macrogen provides as ordered by Client and includes product or products.
  4. "Service" means doing work for Client by Macrogen as ordered and includes service or services.
  5. "Completion date" means the date on which Client pays an invoice and Macrogen provides the result of the service or ships the product ordered by Client.
  6. “Written form” or "in writing" includes not only general written documents, but also electronic documents and other digital formats.
  7. “Business days” means Korean business days excluding Saturday, Sunday and national holiday.

3. Contents and Scope of the Terms

  1. If Client needs any additional service or product or the parties desire to make any changes to the Terms, Macrogen and Client will enter into a separate agreement to provide such additional service or product (price and payment terms will also be included) and to make changes to these Terms.
  2. The terms and conditions of the separate agreement shall take precedence over these Terms, and the agreement shall be made in the written form.

4. Term

These Terms shall become effective as of the date when Client places an order and shall remain in full force and effect till the completion date unless agreed otherwise.

5. Approval of Result and Payment

  1. Macrogen shall invoice Client on the completion date. Client shall pay for the service or product provided by Macrogen within 30 days from the invoice date.
  2. If Macrogen cannot provide any service or product due to client's circumstances, misconduct, or negligence, or the information provided by Client has any problems (such as incorrect address or email address), the date when Macrogen is ready to provide the analysis result or ship the product will be deem to be the completion date.
  3. Macrogen's invoice includes taxes which are generally imposed on sales of product or service, including VAT; provided, however, that if any additional taxes or import taxes are imposed based on the Circumstances of Client, Client shall pay those taxes.
  4. If an invoice is not paid in full within thirty (30) days from the invoice date, any balances not paid will be subject to a ten percent (10% per annum) late payment penalty unless the parties enter into a separate written agreement.
  5. Client agrees that, if Client does not pay an outstanding invoice within the due date, Macrogen may hire a collection agency to recover unpaid balances.
  6. Client shall inspect the result or product within 10 business days from the date of receipt and notify Macrogen if there is any defects or problems. If Macrogen has not given such notification within such time period, the result or product is deemed to have no defects or problems.
  7. If Client notifies Macrogen of any defects or problems of the result or product, within the aforementioned time period and the parties agree that such defects or problems needs to be fixed or that sample reanalysis or a new product needs to be provided, Macrogen shall provide reanalysis result or a new product within the time period agreed by the parties.
  8. If re-analysis of the service result or re-supply of the new product set forth in Section 5.7 is caused by Client (such as provision of defective samples), Client shall bear the additional cost.
  9. When Client orders a service or a product for which the price is not confirmed at the time of placement of the order, Macrogen shall invoice on the date on which Macrogen provides the sercice result or ships the product. If Client disputes any invoiced charges, Client shall notify Macrogen of the disputed items within five (5) business days from the invoice date. If Client does not notify Macrogen of the disputed items within such period, the invoice is deemed to be accepted by the Client.

6. Storage of Samples and Analysis Results

  1. Macrogen, based on its internal policy, stores samples and related data for the period as specified in the following table unless requested otherwise by Client.
    Service nameAnalysis sampleData
    CES90 calendar days3 years
    OligoN/A3 years
    NGS90 calendar days30 calendar days
    Clinical90 calendar days90 calendar days
    Chip90 calendar days90 calendar days
  2. Macrogen will destroy the samples and related data when the period of time specified in the table above expires.
  3. Macrogen, based on its internal policy, stores the samples and related data into commonly used storage protocols with reasonable care in the relevant industry unless requested otherwise by Client.
  4. If Client needs additional storage or additional storage period, Client shall notify Macrogen in advance. if additional storage or additional storage period incurs any additional costs, Macrogen shall notify Client of the costs and other relevant conditions.
  5. If Client requests destruction of samples or data, Macrogen shall faithfully perform the destruction procedure; provided, however, that Client shall request the destruction in writing.

7. Information Security

  1. Macrogen complies with Personal Information Protection Act, Bioethics and Safety Act, and other applicable laws and regulations related to processing orders and complies with all relevant laws and regulations of the Republic of Korea in respect of the sample analysis and storage of data.
  2. If laws of other countries are applied to the analysis or storage of data, Macrogen shall comply with those laws and regulations only if Client provides relevant information or requests such compliance.

8. Faithful Performance and Mutual Cooperation

  1. Client and Macrogen shall faithfully perform their duties under these Terms.
  2. Client and Macrogen may discuss client's order from time to time and shall cooperate with each other if necessary.

9. Confidentiality

  1. Each of the Parties agrees to keep strictly secret and confidential and use Confidential Information, including information related to each party's business management, trade secrets, technology, Clients, sample providers and any other information that should reasonably be recognized as Confidential Information ("Confidential Information"), only for the purpose of processing the order pursuant to these Terms. Notwithstanding anything in the foregoing to the contrary, each party may disclose Confidential Information pursuant to any law or legal procedure, provided that each party promptly notifies the other party in writing of such demand for disclosure.
  2. Each party shall not directly or indirectly disclose Confidential Information to any third party without the prior written consent of the other party.
  3. Each party shall not disclose Confidential Information to any third party, except the minimum number of employees who need to know such Confidential Information to process the order pursuant to these Terms.
  4. The obligations specified in Sections 9.1, 9.2, and 9.3 shall not apply to any Information which, as the Receiving Party shall demonstrate, by substantial supporting documents, at the time of disclosure:
    1. is already known to the Receiving Party;
    2. is received independently by the Receiving Party from a third party free to lawfully disclose such information to the Receiving Party;
    3. is independently developed by the Receiving Party without use of the Confidential Information; or
    4. is already in the public domain or in the future becomes part of the public domain, through no breach of these Terms.
  5. The obligations set forth in this Article shall remain in effect for two (2) years after the date of termination or expiration of these Terms.

10. Termination and Indemnification

  1. Each Party shall have the right to terminate the order and claim damages
    1. if the other Party or its creditors or any other eligible party files for its liquidation, bankruptcy, reorganization, composition or dissolution, or if the other Party is unable to pay any kind of debts as they become due, or the creditors of the other Party have taken over its management;
    2. if either party violates these Terms intentionally or by gross negligence or damages or destroys the other party or any third party's fame or property;
    3. if either party suspends performance of these Terms without good cause or interferes with the processing of the order;
    4. if the order cannot be processed due to natural disasters, economic circumstances, sudden changes in financial conditions, or other reasons for the event of force majeure; or
    5. if, during the period of these terms, either party does not cooperate with the other party to accomplish the purpose of these Terms or it is reasonably considered to be difficult to expect such cooperation.
  2. If either party makes any material breach of any terms or conditions of these Terms and fails to cure such breach within ten (10) business days after receiving written notice to cure from the other party, the other party may terminate the order pursuant to these terms.
  3. If the order is terminated pursuant to this Article, the party caused the termination shall indemnify the other party from all damages, costs, liabilities and expenses arising out of or resulting from the termination. Termination of Order does not mean an exemption from the liability for damages unless agreed otherwise.
  4. Other than the termination of these Terms pursuant to this Article, if either party has incurred damages to the other party in violation of any terms or conditions of these Terms, the party caused damages shall indemnify the other party from all such damages; provided, however, that Macrogen's Indemnifiable Costs will not exceed the total amount paid by Client for each order.

11. Technical Support and Consulting Service

After placing an order, Client may request and receive additional technical support or consulting service from Macrogen. In the event that such support or service incur any additional costs, Macrogen shall notify and discuss with the client in advance.

12. Dispute Resolution

  1. These Terms shall be governed by and construed in accordance with the laws of the Republic of Korea.
  2. Any disputes arising out of or in connection with these Terms shall be finally settled by arbitration in accordance with the International Arbitration Rules of the Korean Commercial Arbitration Board. The place of arbitration will be Seoul, Republic of Korea. The award rendered by the arbitrator(s) shall be final and binding upon the parties concerned.

13. General

  1. Client agrees that these Terms apply to all service and product orders by Client through Macrogen's Online Ordering System; Provided, however, if Macrogen and Client enter into any separate agreement, the agreement takes precedence over these Terms.
  2. Client has read and understood the main contents of these Terms and Conditions prior to placing an order and agrees that these Terms will apply to the order.
  3. When there is any changes to these Terms, Macrogen will notify Client of such changes through email or Macrogen's website. Revised Terms and Conditions will be applied to the orders placed after the effective date of those Terms.
  4. If any Client disputes any part of the revised Terms, the Client shall notify Macrogen, and Macrogen shall take necessary measures (such as deleting the Client's account) to prevent the revised Terms from being applied to the Client.
Close

Terms of Request

(주)마크로젠은 주문자의 요청에 따라 위 주문 내역에 관하여 다음 계약조건(이하 “본 약관”)에 따라 공급한다.

제1조 (본 약관의 목적과 범위)

  1. 본 약관은 주문자가 의뢰한 내용에 따라 마크로젠이 용역 서비스 및 주문 제품을 공급함에 있어 양 당사자 간의 권리와 의무를 규정하고 상호 이를 성실히 이행하는데 그 목적이 있다.
  2. 주문자가 서비스와 제품을 함께 주문한 경우에는 본 약관 전체 내용이 적용되며, 서비스 또는 제품만 주문한 경우에는 본 약관 내용 중 해당 주문 종류 관련된 부분만 적용된다.

제2조 (용어의 정의)

본 약관의 적용을 위한 용어는 다른 특별한 언급이 없는 한 다음 각 호의 의미로 사용된다.

  1. 주문자는 용역을 의뢰하거나 제품의 공급을 요청한 자, 마크로젠은 용역 또는 제품을 공급하는 자이다.
  2. “용역” 또는 “서비스”라 함은 주문자가 마크로젠에 의뢰한 분석 건을 말한다.
  3. “결과물”이라 함은 의뢰한 용역서비스-주문의 결과로 발생한 분석 결과 자료를 의미한다.
  4. “제품”이라 함은 주문 내용에 따라 마크로젠이 제공 하는 제품을 의미한다.
  5. “서면”이라 함은 일반적인 서면 형식뿐만 아니라 전자문서 등 전산상 기록에 의해 증명할 수 있는 형식을 포함한다.

제3조 (약관의 적용 범위)

  1. 본 약관의 분석서비스 제품의 내역 및 그 단가는 주문서에 첨부된 견적서 내용에 따른다.
  2. 주문자가 주문한 내용 외에 추가 서비스 또는 제품을 필요로 하거나 주문 세부 내용의 변경이 필요한 경우에는 마크로젠과 주문자는 상호간에 합의된 별도 특약에 따라 항목 추가/변경 또는 비용 책정을 진행한다.
  3. 전항에 따라 합의된 특약 내용은 본 약관에 우선하며, 양 당사자의 정당한 대표자에 의한 서명 (전자서명 포함)이 포함된 서면으로 작성되어야 한다.

제4조 (본 약관의 기간)

본 약관의 유효기간은 별도로 양 당사자의 서면합의에 의한 변경이 없는 한 주문 등록일로부터 서비스 또는 제품 제공과 대금지급을 포함한 본 약관에 따른 모든 이행사항이 완료되는 시점까지로 한다.

제5조 (결과물 승인 및 대금의 지급)

  1. 마크로젠은 주문자와 협의한 용역기간 내에 주문자에게 용역 결과물을 제공하며, 용역 결과 제공일부터 용역에 대한 대금청구권을 보유한다. 대금청구권 발생 후 주문자는 별도의 약정이 없는 한 대금청구일로부터 30일 이내에 주문한 용역에 관한 대금을 카드결제 또는 마크로젠이 지정한 계좌에 현금으로 일괄 지급한다.
  2. 마크로젠은 주문자와 협의한 납기일 내에 주문자에게 제품을 발송하며, 제품 발송일로부터 제품에 대한 대금청구권을 보유한다. 대금청구권 발생 후 주문자는 별도의 약정이 없는 한 대금청구일로부터 30일 이내에 마크로젠에 주문한 제품에 관한 대금을 카드결제 또는 마크로젠이 지정한 계좌에 현금으로 일괄 지급한다.
  3. 주문자측의 사정, 주문자의 과실 또는 주문자의 통제 영역에 있는 정보제공 (예, 수령 이메일 또는 주소 오기입), 등으로 마크로젠이 결과물 또는 제품을 제공할 수 없는 경우에는 마크로젠이 제공할 결과물 또는 발송할 제품의 준비를 완료한 일자를 해당 용역/제품에 대한 대금청구권 발생일로 한다.
  4. 마크로젠은 부가가치세 등 통상적으로 용역 또는 제품의 제공에 납부하여야 하는 세금을 포함하여 대금을 청구한다. 다만, 용역 또는 제품의 제공과 관련하여 개별 주문자의 사정에 따라 추가적으로 세금 또는 관세 등이 발생하는 경우 해당 비용은 주문자가 부담한다.
  5. 별도의 서면 합의 없이 본 조 제1항 또는 제2항의 기한 내에 대금이 지급되지 않을 경우에는 마크로젠은 주문자에게 해당 대금 및 연이율 10%를 기준으로 산정한 지연배상금을 별도 청구할 수 있으며, 미지급된 대금 수령을 위하여 외부 기관에 추심을 의뢰할 수 있다.
  6. 주문자는 결과물 제출 또는 제품 수령 후 10 영업일 이내에 해당 결과물 또는 제품을 검수하여, 검수결과를 마크로젠에 통지하여야 하며, 동 기간 내에 통지하지 않는 경우에는 결과물 또는 제품에 대한 이의가 없는 것으로 간주한다.
  7. 주문자가 전항의 기간 내에 검수결과 이상 내역을 마크로젠에게 통지하고, 서비스의 재수행 또는 제품의 재납품이 필요하다고 양 당사자 간에 합의한 경우에는 마크로젠은 주문자와 협의한 기간 내에 재분석 결과물을 제출하거나 대체 상품을 제공한다. 이 경우 검수결과 이상이 주문자가 제공한 샘플상의 원인 또는 주문정보 오기재 등 주문자의 귀책사유에 의한 경우에는 주문자가 추가 소요 비용을 부담한다.
  8. 주문자의 요청에 의해 주문한 분석 샘플 또는 제품 수량의 변동이 발생하는 경우에는 항목 당단가는 유지하되, 수량비율을 조정하여 총 주문 액수를 변경할 수 있다.
  9. 마크로젠은 용역 결과물 제출 또는 제품이 발송된 후 30일 내에 청구서를 발행하여 대금을 청구한다. 주문자는 대금청구서상 최종금액에 이의가 있는 경우에는 청구서 수령일로부터 5 영업일 이내 마크로젠에 통지하여야 한다. 만약, 동 기간 내에 주문자로부터 이의제기가 없는 경우에는 해당 최종 금액에 동의한 것으로 간주되며, 주문자는 해당 청구서 수령일로부터 30일 이내에 최종금액을 카드결제 또는 마크로젠이 지정한 계좌에 현금으로 일괄 지급한다.

제6조 (샘플 및 분석 결과의 보관)

  1. 마크로젠은 주문자의 별도 요청이 없는 한 내부 정책에 따라 다음 표의 기간 동안에 한하여 의뢰된 샘플과 관련한 데이터를 보관한다.
    1. 분석샘플 : 3개월
    2. 데이터 : 3개월
  2. 마크로젠은 전항에 명기한 보관기관이 도과한 경우에는 그 샘플 또는 데이터를 임의로 폐기처분 할 수 있다.
  3. 마크로젠은 주문자로부터 별도의 요청이 없는 한 내부 규정상 일반적으로 사용되는 보관 프로토콜 및 업계에서 통용되는 일반적인 주의의무를 다하여 샘플 또는 데이터를 보관한다.
  4. 샘플 또는 데이터의 보관과 관련하여 별도의 추가조치 또는 추가 보관 기간이 필요한 경우에는 주문자는 관련내용을 마크로젠에 사전에 알려야 한다. 추가 조치와 관련 별도의 추가 비용이 발생하는 경우에는 마크로젠은 관련 비용 및 조건을 별도로 주문자에게 안내하며, 이 경우 일반적인 고객에게 제시되는 요율에 따라 추가 비용을 청구할 수 있다.
  5. 주문자가 의뢰 시 별도의 서면 요청으로 샘플 또는 데이터의 폐기를 요청한 경우에는 마크로젠은 그 요청내용에 따른 폐기조치를 성실히 이행한다.

제7조 (정보의 보호)

  1. 마크로젠은 분석 대상과 관련하여 개인정보 보호법 및 생명윤리법 기타 관련법령을 준수하며, 데이터의 분석 및 보관과 관련하여 대한민국의 관련법령을 준수한다.
  2. 마크로젠은 주문 대상 데이터의 분석 및 데이터의 보관과 관련하여 대한민국을 제외한 국가의 법률이 적용되는 경우에는 해당 국가의 관련법령을 준수한다. 다만, 이는 주문자가 마크로젠에 해당 국가의 특정 법률이 적용된다는 사실과 관련한 정보를 별도로 제공한 경우에 한다.

제8조 (신의성실 및 상호협조)

  1. 주문자와 마크로젠은 신의를 가지고 본 약관의 각 조항을 성실하게 이행하여야 한다.
  2. 주문자와 마크로젠은 주문 내용에 관하여 수시로 협의 할 수 있으며, 필요한 사항은 상호 협조하여야 한다.

제9조 (비밀유지)

  1. 각 당사자는 본 약관에 이행 과정에서 지득 또는 입수한 상대방 당사자의 경영상의 정보 기타 일체의 영업 혹은 기술상의 정보, 고객 및 샘플 제공자에 관한 정보를 포함한 비밀로 간주되는 일체의 정보 (이하 “비밀정보”)에 관하여 업무상 비밀을 유지하여야 하며, 본 약관 이행 이외에 다른 용도로 사용해서는 안 된다. 다만, 법률상 또는 법률 절차상 공개가 요구되는 경우에는 예외로 하며, 해당 사유가 발생한 경우에는 지체 없이 상대방에게 통지한다.
  2. 각 당사자는 상대방 당사자의 명시적인 서면 동의 없이는 누구에게도 비밀정보를 직접적이거나 간접적으로, 불특정인 또는 특정인에게 공개적으로 또는 비공개적으로 유출하거나 누설하지 아니할 의무를 부담하며, 비밀정보가 무단으로 유출되지 않도록 보안관리를 해야 한다.
  3. 각 당사자는 본 약관에 따른 의무 이행을 위하여 알아야 할 필요가 있는 최소한의 임직원을 제외한 어떠한 제3자에게도 위 비밀정보를 공개하여서는 안 된다.
  4. 오직 다음 각 호의 정보에 대해서만 본 조 제1항에서 제3항까지의 의무가 면제된다.
    1. 비밀보호유지의 의무를 지는 일 없이 이미 보유 하고 있는 정보
    2. 비밀보호유지의 의무를 지는 일 없이 제 3자로부터 정당하게 입수한 정보
    3. 상대방으로부터 제공받은 정보에 의존 없이 독자적으로 개발한 정보
    4. 본 약관에 위반하는 일 없이, 수령의 전후를 불문하고 공지된 정보
  5. 본 조의 비밀유지 의무는 본 계약의 종료, 만료 또는 해지일 이후에도 5년간 유효한 것으로 한다.

제10조 (주문 취소)

  1. 주문자와 마크로젠은 다음 각 호의 어느 하나에 해당하는 사유가 발생한 경우에는 주문을 취소 할 수 있다.
    1. 주문자 또는 마크로젠 자신에 의한 회생, 파산 절차의 신청이 있거나, 채권자의 신청에 의해 동 절차가 개시된 경우
    2. 주문자 또는 마크로젠이 본 약관을 고의 또는 중대한 과실로 위반하거나 상대방 또는 제 3 자의명예훼손, 재산상의 손해를 발생시킨 경우
    3. 주문자 또는 마크로젠이 정당한 이유 없이 본 약관의 이행을 중단하거나 주문 내용의 이행을 방해하는 경우
    4. 천재지변이나 경제사정 또는 금융여건의 급격한 변화, 기타 불가항력의 사유가 발생하여 주문내용을 이행을 수행할 수 없는 경우
    5. 주문자 또는 마크로젠이 정당한 사유 없이 본 약관을 위반하고, 상대방으로부터 서면으로 시정요구를 받은 날로부터 10영업일 이내에 해당 위반사항을 시정하지 않은 경우
    6. 기타 주문 내용을 이행할 수 없는 객관적인 사유가 발생한 경우
  2. 본 조 또는 기타 사유에 의하여 주문이 취소 될 경우에는 주문 취소에 관하여 귀책사유 있는당사자는 상대방에 대하여 주문 취소로 인한 손해를 배상하여야 한다.

제11조 (손해배상)

주문자 또는 마크로젠이 본 약관에서 정한 사항을 위반하여 상대방에게 손해를 입힌 경우에는 귀책사유가 있는 당사자는 상대방의 손해를 배상하여야 한다. 다만, 주문자에게 부담하는 마크로젠의 손해배상 범위는 관련 주문건에 해당하는 대금의 총액을 초과할 수 없다.

제12조 (기술지원 및 자문)

주문 후 주문자는 마크로젠에 추가적인 기술 지원 또는 자문을 요청 할 수 있으며, 이에 따른 별도 비용이 발생하는 경우에는 마크로젠은 사전에 이를 주문자에게 안내하고 주문자와 관련사항을 협의하여야 한다.

제13조 (권리 및 의무의 양도 제한)

각 당사자는 상대방의 사전 서면동의 없이 본 약관상의 지위, 권리 또는 의무의 전부 또는 일부를 임의로 제 3자에게 양도, 담보제공 또는 대여 등 일체의 처분행위를 할 수 없다.

제14조 (분쟁 해결)

  1. 용역수행 또는 제품공급에 필요한 사항으로서 본 약관에서 정하지 아니한 사항 또는 본 약관의 내용에 관하여 주문자와 마크로젠 사이에 의견이 다른 경우에는 주문자와 마크로젠의 합의된 의사에 따르고, 주문자와 마크로젠 사이에 계약 해석과 관련한 합의가 이루어 지지 않은 경우에는 관련 법령에 따른다.
  2. 본 약관에 관한 분쟁의 해결은 통상의 민사재판에 의한다. 이 경우 양 당사자는 서울남부지방법원을 전속적 합의 관할 법원으로 하여 해결한다.

제15조 (약관의 효력)

  1. 주문자는 본 약관이 마크로젠이 제공한 주문 플랫폼을 통해 마크로젠의 용역 또는 제품을 주문하는 모든 주문 건에 적용된다는 데에 동의한다. 다만, 주문자와 마크로젠이 별도의 서면 합의를 한 경우에는 해당 합의가 본 약관에 우선한다.
  2. 주문자는 주문 이전에 본 약관의 내용을 읽고 이해하였으며, 주문 행위로써 본 약관의 적용에 동의한다.
  3. 본 약관의 내용이 변경되는 경우에는 마크로젠은 주문자의 이메일 또는 플랫폼 공지 등을 통해 사전에 변경 내용을 주문자에게 통지한다.
  4. 주문자가 본 약관의 변경내용에 관하여 이의가 있는 경우에는 변경된 약관의 시행일 전에 마크로젠에 통지하며, 마크로젠은 별도 서면합의 체결 및 계정삭제 등의 조치를 통해 해당 주문자에게 변경내용이 적용되지 않도록 할 수 있다.
Close

Como usar Pick-Up servicio con GRATIS en Santiago?

How to use Pick-Up service for free in Santiago?

Tienes pregunta?
Contacto +56 9 5845 1395

Close

Envianos tus muestras de forma segura a Chile

The safest way to deliver your sample to Chile?

Tienes pregunta?
Contacto +56 9 5845 1395