Macrogen, Inc. provides service or product in accordance with the following terms and conditions (the "Terms") at the client's request.
1. Purpose
The purpose of the Terms is to establish the rights and obligations of Macrogen and Client with respect to Macrogen's service or product as requested or ordered by Client. Macrogen and Client shall faithfully perform their duties as specified in these Terms.
2. Definition
Unless specified otherwise in these Terms, the following terms have the meanings set forth herein.
- "Client" is a company or a person who orders service or product, and "Macrogen" is the provider of the service or product to Client.
- "Result" means the result of an analysis ordered by Client.
- "Product" means goods that Macrogen provides as ordered by Client and includes product or products.
- "Service" means doing work for Client by Macrogen as ordered and includes service or services.
- "Completion date" means the date on which Client pays an invoice and Macrogen provides the result of the service or ships the product ordered by Client.
- “Written form” or "in writing" includes not only general written documents, but also electronic documents and other digital formats.
- “Business days” means Korean business days excluding Saturday, Sunday and national holiday.
3. Contents and Scope of the Terms
- If Client needs any additional service or product or the parties desire to make any changes to the Terms, Macrogen and Client will enter into a separate agreement to provide such additional service or product (price and payment terms will also be included) and to make changes to these Terms.
- The terms and conditions of the separate agreement shall take precedence over these Terms, and the agreement shall be made in the written form.
4. Term
These Terms shall become effective as of the date when Client places an order and shall remain in full force and effect till the completion date unless agreed otherwise.
5. Approval of Result and Payment
- Macrogen shall invoice Client on the completion date. Client shall pay for the service or product provided by Macrogen within 30 days from the invoice date.
- If Macrogen cannot provide any service or product due to client's circumstances, misconduct, or negligence, or the information provided by Client has any problems (such as incorrect address or email address), the date when Macrogen is ready to provide the analysis result or ship the product will be deem to be the completion date.
- Macrogen's invoice includes taxes which are generally imposed on sales of product or service, including VAT; provided, however, that if any additional taxes or import taxes are imposed based on the Circumstances of Client, Client shall pay those taxes.
- If an invoice is not paid in full within thirty (30) days from the invoice date, any balances not paid will be subject to a ten percent (10% per annum) late payment penalty unless the parties enter into a separate written agreement.
- Client agrees that, if Client does not pay an outstanding invoice within the due date, Macrogen may hire a collection agency to recover unpaid balances.
- Client shall inspect the result or product within 10 business days from the date of receipt and notify Macrogen if there is any defects or problems. If Macrogen has not given such notification within such time period, the result or product is deemed to have no defects or problems.
- If Client notifies Macrogen of any defects or problems of the result or product, within the aforementioned time period and the parties agree that such defects or problems needs to be fixed or that sample reanalysis or a new product needs to be provided, Macrogen shall provide reanalysis result or a new product within the time period agreed by the parties.
- If re-analysis of the service result or re-supply of the new product set forth in Section 5.7 is caused by Client (such as provision of defective samples), Client shall bear the additional cost.
- When Client orders a service or a product for which the price is not confirmed at the time of placement of the order, Macrogen shall invoice on the date on which Macrogen provides the sercice result or ships the product. If Client disputes any invoiced charges, Client shall notify Macrogen of the disputed items within five (5) business days from the invoice date. If Client does not notify Macrogen of the disputed items within such period, the invoice is deemed to be accepted by the Client.
6. Storage of Samples and Analysis Results
-
Macrogen, based on its internal policy, stores samples and related data for the period as specified in the following table unless requested otherwise by Client.
Service name Analysis sample data CES 3 months 3 years Oligo N/A 3 years NGS 3 months 3 months Clinical 3 months 3 months Chip 3 months 3 months - Macrogen will destroy the samples and related data when the period of time specified in the table above expires.
- Macrogen, based on its internal policy, stores the samples and related data into commonly used storage protocols with reasonable care in the relevant industry unless requested otherwise by Client.
- If Client needs additional storage or additional storage period, Client shall notify Macrogen in advance. if additional storage or additional storage period incurs any additional costs, Macrogen shall notify Client of the costs and other relevant conditions.
- If Client requests destruction of samples or data, Macrogen shall faithfully perform the destruction procedure; provided, however, that Client shall request the destruction in writing.
7. Information Security
- Macrogen complies with Personal Information Protection Act, Bioethics and Safety Act, and other applicable laws and regulations related to processing orders and complies with all relevant laws and regulations of the Republic of Korea in respect of the sample analysis and storage of data.
- If laws of other countries are applied to the analysis or storage of data, Macrogen shall comply with those laws and regulations only if Client provides relevant information or requests such compliance.
8. Faithful Performance and Mutual Cooperation
- Client and Macrogen shall faithfully perform their duties under these Terms.
- Client and Macrogen may discuss client's order from time to time and shall cooperate with each other if necessary.
9. Confidentiality
- Each of the Parties agrees to keep strictly secret and confidential and use Confidential Information, including information related to each party's business management, trade secrets, technology, Clients, sample providers and any other information that should reasonably be recognized as Confidential Information ("Confidential Information"), only for the purpose of processing the order pursuant to these Terms. Notwithstanding anything in the foregoing to the contrary, each party may disclose Confidential Information pursuant to any law or legal procedure, provided that each party promptly notifies the other party in writing of such demand for disclosure.
- Each party shall not directly or indirectly disclose Confidential Information to any third party without the prior written consent of the other party.
- Each party shall not disclose Confidential Information to any third party, except the minimum number of employees who need to know such Confidential Information to process the order pursuant to these Terms.
- The obligations specified in Sections 9.1, 9.2, and 9.3 shall not apply to any Information which, as the Receiving Party shall demonstrate, by substantial supporting documents, at the time of disclosure:
- is already known to the Receiving Party;
- is received independently by the Receiving Party from a third party free to lawfully disclose such information to the Receiving Party;
- is independently developed by the Receiving Party without use of the Confidential Information; or
- is already in the public domain or in the future becomes part of the public domain, through no breach of these Terms.
- The obligations set forth in this Article shall remain in effect for two (2) years after the date of termination or expiration of these Terms.
10. Termination and Indemnification
- Each Party shall have the right to terminate the order and claim damages
- if the other Party or its creditors or any other eligible party files for its liquidation, bankruptcy, reorganization, composition or dissolution, or if the other Party is unable to pay any kind of debts as they become due, or the creditors of the other Party have taken over its management;
- if either party violates these Terms intentionally or by gross negligence or damages or destroys the other party or any third party's fame or property;
- if either party suspends performance of these Terms without good cause or interferes with the processing of the order;
- if the order cannot be processed due to natural disasters, economic circumstances, sudden changes in financial conditions, or other reasons for the event of force majeure; or
- if, during the period of these terms, either party does not cooperate with the other party to accomplish the purpose of these Terms or it is reasonably considered to be difficult to expect such cooperation.
- If either party makes any material breach of any terms or conditions of these Terms and fails to cure such breach within ten (10) business days after receiving written notice to cure from the other party, the other party may terminate the order pursuant to these terms.
- If the order is terminated pursuant to this Article, the party caused the termination shall indemnify the other party from all damages, costs, liabilities and expenses arising out of or resulting from the termination. Termination of Order does not mean an exemption from the liability for damages unless agreed otherwise.
- Other than the termination of these Terms pursuant to this Article, if either party has incurred damages to the other party in violation of any terms or conditions of these Terms, the party caused damages shall indemnify the other party from all such damages; provided, however, that Macrogen's Indemnifiable Costs will not exceed the total amount paid by Client for each order.
11. Technical Support and Consulting Service
After placing an order, Client may request and receive additional technical support or consulting service from Macrogen. In the event that such support or service incur any additional costs, Macrogen shall notify and discuss with the client in advance.
12. Dispute Resolution
- These Terms shall be governed by and construed in accordance with the laws of the Republic of Korea.
- Any disputes arising out of or in connection with these Terms shall be finally settled by arbitration in accordance with the International Arbitration Rules of the Korean Commercial Arbitration Board. The place of arbitration will be Seoul, Republic of Korea. The award rendered by the arbitrator(s) shall be final and binding upon the parties concerned.
13. General
- Client agrees that these Terms apply to all service and product orders by Client through Macrogen's Online Ordering System; Provided, however, if Macrogen and Client enter into any separate agreement, the agreement takes precedence over these Terms.
- Client has read and understood the main contents of these Terms and Conditions prior to placing an order and agrees that these Terms will apply to the order.
- When there is any changes to these Terms, Macrogen will notify Client of such changes through email or Macrogen's website. Revised Terms and Conditions will be applied to the orders placed after the effective date of those Terms.
- If any Client disputes any part of the revised Terms, the Client shall notify Macrogen, and Macrogen shall take necessary measures (such as deleting the Client's account) to prevent the revised Terms from being applied to the Client.
(주)마크로젠은 주문자의 요청에 따라 위 주문 내역에 관하여 다음 계약조건(이하 “본 약관”)에 따라 공급한다.
제1조 (본 약관의 목적과 범위)
- 본 약관은 주문자가 의뢰한 내용에 따라 마크로젠이 용역 서비스 및 주문 제품을 공급함에 있어 양 당사자 간의 권리와 의무를 규정하고 상호 이를 성실히 이행하는데 그 목적이 있다.
- 주문자가 서비스와 제품을 함께 주문한 경우에는 본 약관 전체 내용이 적용되며, 서비스 또는 제품만 주문한 경우에는 본 약관 내용 중 해당 주문 종류 관련된 부분만 적용된다.
제2조 (용어의 정의)
본 약관의 적용을 위한 용어는 다른 특별한 언급이 없는 한 다음 각 호의 의미로 사용된다.
- 주문자는 용역을 의뢰하거나 제품의 공급을 요청한 자, 마크로젠은 용역 또는 제품을 공급하는 자이다.
- “용역” 또는 “서비스”라 함은 주문자가 마크로젠에 의뢰한 분석 건을 말한다.
- “결과물”이라 함은 의뢰한 용역서비스-주문의 결과로 발생한 분석 결과 자료를 의미한다.
- “제품”이라 함은 주문 내용에 따라 마크로젠이 제공 하는 제품을 의미한다.
- “서면”이라 함은 일반적인 서면 형식뿐만 아니라 전자문서 등 전산상 기록에 의해 증명할 수 있는 형식을 포함한다.
제3조 (약관의 적용 범위)
- 본 약관의 분석서비스 제품의 내역 및 그 단가는 주문서에 첨부된 견적서 내용에 따른다.
- 주문자가 주문한 내용 외에 추가 서비스 또는 제품을 필요로 하거나 주문 세부 내용의 변경이 필요한 경우에는 마크로젠과 주문자는 상호간에 합의된 별도 특약에 따라 항목 추가/변경 또는 비용 책정을 진행한다.
- 전항에 따라 합의된 특약 내용은 본 약관에 우선하며, 양 당사자의 정당한 대표자에 의한 서명 (전자서명 포함)이 포함된 서면으로 작성되어야 한다.
제4조 (본 약관의 기간)
본 약관의 유효기간은 별도로 양 당사자의 서면합의에 의한 변경이 없는 한 주문 등록일로부터 서비스 또는 제품 제공과 대금지급을 포함한 본 약관에 따른 모든 이행사항이 완료되는 시점까지로 한다.
제5조 (결과물 승인 및 대금의 지급)
- 마크로젠은 주문자와 협의한 용역기간 내에 주문자에게 용역 결과물을 제공하며, 용역 결과 제공일부터 용역에 대한 대금청구권을 보유한다. 대금청구권 발생 후 주문자는 별도의 약정이 없는 한 대금청구일로부터 30일 이내에 주문한 용역에 관한 대금을 카드결제 또는 마크로젠이 지정한 계좌에 현금으로 일괄 지급한다.
- 마크로젠은 주문자와 협의한 납기일 내에 주문자에게 제품을 발송하며, 제품 발송일로부터 제품에 대한 대금청구권을 보유한다. 대금청구권 발생 후 주문자는 별도의 약정이 없는 한 대금청구일로부터 30일 이내에 마크로젠에 주문한 제품에 관한 대금을 카드결제 또는 마크로젠이 지정한 계좌에 현금으로 일괄 지급한다.
- 주문자측의 사정, 주문자의 과실 또는 주문자의 통제 영역에 있는 정보제공 (예, 수령 이메일 또는 주소 오기입), 등으로 마크로젠이 결과물 또는 제품을 제공할 수 없는 경우에는 마크로젠이 제공할 결과물 또는 발송할 제품의 준비를 완료한 일자를 해당 용역/제품에 대한 대금청구권 발생일로 한다.
- 마크로젠은 부가가치세 등 통상적으로 용역 또는 제품의 제공에 납부하여야 하는 세금을 포함하여 대금을 청구한다. 다만, 용역 또는 제품의 제공과 관련하여 개별 주문자의 사정에 따라 추가적으로 세금 또는 관세 등이 발생하는 경우 해당 비용은 주문자가 부담한다.
- 별도의 서면 합의 없이 본 조 제1항 또는 제2항의 기한 내에 대금이 지급되지 않을 경우에는 마크로젠은 주문자에게 해당 대금 및 연이율 10%를 기준으로 산정한 지연배상금을 별도 청구할 수 있으며, 미지급된 대금 수령을 위하여 외부 기관에 추심을 의뢰할 수 있다.
- 주문자는 결과물 제출 또는 제품 수령 후 10 영업일 이내에 해당 결과물 또는 제품을 검수하여, 검수결과를 마크로젠에 통지하여야 하며, 동 기간 내에 통지하지 않는 경우에는 결과물 또는 제품에 대한 이의가 없는 것으로 간주한다.
- 주문자가 전항의 기간 내에 검수결과 이상 내역을 마크로젠에게 통지하고, 서비스의 재수행 또는 제품의 재납품이 필요하다고 양 당사자 간에 합의한 경우에는 마크로젠은 주문자와 협의한 기간 내에 재분석 결과물을 제출하거나 대체 상품을 제공한다. 이 경우 검수결과 이상이 주문자가 제공한 샘플상의 원인 또는 주문정보 오기재 등 주문자의 귀책사유에 의한 경우에는 주문자가 추가 소요 비용을 부담한다.
- 주문자의 요청에 의해 주문한 분석 샘플 또는 제품 수량의 변동이 발생하는 경우에는 항목 당단가는 유지하되, 수량비율을 조정하여 총 주문 액수를 변경할 수 있다.
- 마크로젠은 용역 결과물 제출 또는 제품이 발송된 후 30일 내에 청구서를 발행하여 대금을 청구한다. 주문자는 대금청구서상 최종금액에 이의가 있는 경우에는 청구서 수령일로부터 5 영업일 이내 마크로젠에 통지하여야 한다. 만약, 동 기간 내에 주문자로부터 이의제기가 없는 경우에는 해당 최종 금액에 동의한 것으로 간주되며, 주문자는 해당 청구서 수령일로부터 30일 이내에 최종금액을 카드결제 또는 마크로젠이 지정한 계좌에 현금으로 일괄 지급한다.
제6조 (샘플 및 분석 결과의 보관)
- 마크로젠은 주문자의 별도 요청이 없는 한 내부 정책에 따라 다음 표의 기간 동안에 한하여 의뢰된 샘플과 관련한 데이터를 보관한다.
- 분석샘플 : 3개월
- 데이터 : 3개월
- 마크로젠은 전항에 명기한 보관기관이 도과한 경우에는 그 샘플 또는 데이터를 임의로 폐기처분 할 수 있다.
- 마크로젠은 주문자로부터 별도의 요청이 없는 한 내부 규정상 일반적으로 사용되는 보관 프로토콜 및 업계에서 통용되는 일반적인 주의의무를 다하여 샘플 또는 데이터를 보관한다.
- 샘플 또는 데이터의 보관과 관련하여 별도의 추가조치 또는 추가 보관 기간이 필요한 경우에는 주문자는 관련내용을 마크로젠에 사전에 알려야 한다. 추가 조치와 관련 별도의 추가 비용이 발생하는 경우에는 마크로젠은 관련 비용 및 조건을 별도로 주문자에게 안내하며, 이 경우 일반적인 고객에게 제시되는 요율에 따라 추가 비용을 청구할 수 있다.
- 주문자가 의뢰 시 별도의 서면 요청으로 샘플 또는 데이터의 폐기를 요청한 경우에는 마크로젠은 그 요청내용에 따른 폐기조치를 성실히 이행한다.
제7조 (정보의 보호)
- 마크로젠은 분석 대상과 관련하여 개인정보 보호법 및 생명윤리법 기타 관련법령을 준수하며, 데이터의 분석 및 보관과 관련하여 대한민국의 관련법령을 준수한다.
- 마크로젠은 주문 대상 데이터의 분석 및 데이터의 보관과 관련하여 대한민국을 제외한 국가의 법률이 적용되는 경우에는 해당 국가의 관련법령을 준수한다. 다만, 이는 주문자가 마크로젠에 해당 국가의 특정 법률이 적용된다는 사실과 관련한 정보를 별도로 제공한 경우에 한다.
제8조 (신의성실 및 상호협조)
- 주문자와 마크로젠은 신의를 가지고 본 약관의 각 조항을 성실하게 이행하여야 한다.
- 주문자와 마크로젠은 주문 내용에 관하여 수시로 협의 할 수 있으며, 필요한 사항은 상호 협조하여야 한다.
제9조 (비밀유지)
- 각 당사자는 본 약관에 이행 과정에서 지득 또는 입수한 상대방 당사자의 경영상의 정보 기타 일체의 영업 혹은 기술상의 정보, 고객 및 샘플 제공자에 관한 정보를 포함한 비밀로 간주되는 일체의 정보 (이하 “비밀정보”)에 관하여 업무상 비밀을 유지하여야 하며, 본 약관 이행 이외에 다른 용도로 사용해서는 안 된다. 다만, 법률상 또는 법률 절차상 공개가 요구되는 경우에는 예외로 하며, 해당 사유가 발생한 경우에는 지체 없이 상대방에게 통지한다.
- 각 당사자는 상대방 당사자의 명시적인 서면 동의 없이는 누구에게도 비밀정보를 직접적이거나 간접적으로, 불특정인 또는 특정인에게 공개적으로 또는 비공개적으로 유출하거나 누설하지 아니할 의무를 부담하며, 비밀정보가 무단으로 유출되지 않도록 보안관리를 해야 한다.
- 각 당사자는 본 약관에 따른 의무 이행을 위하여 알아야 할 필요가 있는 최소한의 임직원을 제외한 어떠한 제3자에게도 위 비밀정보를 공개하여서는 안 된다.
- 오직 다음 각 호의 정보에 대해서만 본 조 제1항에서 제3항까지의 의무가 면제된다.
- 비밀보호유지의 의무를 지는 일 없이 이미 보유 하고 있는 정보
- 비밀보호유지의 의무를 지는 일 없이 제 3자로부터 정당하게 입수한 정보
- 상대방으로부터 제공받은 정보에 의존 없이 독자적으로 개발한 정보
- 본 약관에 위반하는 일 없이, 수령의 전후를 불문하고 공지된 정보
- 본 조의 비밀유지 의무는 본 계약의 종료, 만료 또는 해지일 이후에도 5년간 유효한 것으로 한다.
제10조 (주문 취소)
- 주문자와 마크로젠은 다음 각 호의 어느 하나에 해당하는 사유가 발생한 경우에는 주문을 취소 할 수 있다.
- 주문자 또는 마크로젠 자신에 의한 회생, 파산 절차의 신청이 있거나, 채권자의 신청에 의해 동 절차가 개시된 경우
- 주문자 또는 마크로젠이 본 약관을 고의 또는 중대한 과실로 위반하거나 상대방 또는 제 3 자의명예훼손, 재산상의 손해를 발생시킨 경우
- 주문자 또는 마크로젠이 정당한 이유 없이 본 약관의 이행을 중단하거나 주문 내용의 이행을 방해하는 경우
- 천재지변이나 경제사정 또는 금융여건의 급격한 변화, 기타 불가항력의 사유가 발생하여 주문내용을 이행을 수행할 수 없는 경우
- 주문자 또는 마크로젠이 정당한 사유 없이 본 약관을 위반하고, 상대방으로부터 서면으로 시정요구를 받은 날로부터 10영업일 이내에 해당 위반사항을 시정하지 않은 경우
- 기타 주문 내용을 이행할 수 없는 객관적인 사유가 발생한 경우
- 본 조 또는 기타 사유에 의하여 주문이 취소 될 경우에는 주문 취소에 관하여 귀책사유 있는당사자는 상대방에 대하여 주문 취소로 인한 손해를 배상하여야 한다.
제11조 (손해배상)
주문자 또는 마크로젠이 본 약관에서 정한 사항을 위반하여 상대방에게 손해를 입힌 경우에는 귀책사유가 있는 당사자는 상대방의 손해를 배상하여야 한다. 다만, 주문자에게 부담하는 마크로젠의 손해배상 범위는 관련 주문건에 해당하는 대금의 총액을 초과할 수 없다.
제12조 (기술지원 및 자문)
주문 후 주문자는 마크로젠에 추가적인 기술 지원 또는 자문을 요청 할 수 있으며, 이에 따른 별도 비용이 발생하는 경우에는 마크로젠은 사전에 이를 주문자에게 안내하고 주문자와 관련사항을 협의하여야 한다.
제13조 (권리 및 의무의 양도 제한)
각 당사자는 상대방의 사전 서면동의 없이 본 약관상의 지위, 권리 또는 의무의 전부 또는 일부를 임의로 제 3자에게 양도, 담보제공 또는 대여 등 일체의 처분행위를 할 수 없다.
제14조 (분쟁 해결)
- 용역수행 또는 제품공급에 필요한 사항으로서 본 약관에서 정하지 아니한 사항 또는 본 약관의 내용에 관하여 주문자와 마크로젠 사이에 의견이 다른 경우에는 주문자와 마크로젠의 합의된 의사에 따르고, 주문자와 마크로젠 사이에 계약 해석과 관련한 합의가 이루어 지지 않은 경우에는 관련 법령에 따른다.
- 본 약관에 관한 분쟁의 해결은 통상의 민사재판에 의한다. 이 경우 양 당사자는 서울남부지방법원을 전속적 합의 관할 법원으로 하여 해결한다.
제15조 (약관의 효력)
- 주문자는 본 약관이 마크로젠이 제공한 주문 플랫폼을 통해 마크로젠의 용역 또는 제품을 주문하는 모든 주문 건에 적용된다는 데에 동의한다. 다만, 주문자와 마크로젠이 별도의 서면 합의를 한 경우에는 해당 합의가 본 약관에 우선한다.
- 주문자는 주문 이전에 본 약관의 내용을 읽고 이해하였으며, 주문 행위로써 본 약관의 적용에 동의한다.
- 본 약관의 내용이 변경되는 경우에는 마크로젠은 주문자의 이메일 또는 플랫폼 공지 등을 통해 사전에 변경 내용을 주문자에게 통지한다.
- 주문자가 본 약관의 변경내용에 관하여 이의가 있는 경우에는 변경된 약관의 시행일 전에 마크로젠에 통지하며, 마크로젠은 별도 서면합의 체결 및 계정삭제 등의 조치를 통해 해당 주문자에게 변경내용이 적용되지 않도록 할 수 있다.
Como usar Pick-Up servicio con GRATIS en Santiago?
How to use Pick-Up service for free in Santiago?
Tienes pregunta?
Contacto +56 9 5845 1395
Envianos tus muestras de forma segura a Chile
The safest way to deliver your sample to Chile?
Tienes pregunta?
Contacto +56 9 5845 1395
CES
Capillary Electrophoresis Sequencing (CES) is a service that analyzes DNA sequences using a biochemical method.
The CES service of Macrogen maximizes customer satisfaction with various service lineups such as identification services, which involves the differentiation and identification of species of living organisms, fragment analysis services, and customized sequencing services newly applied from the existing sequencing method, as well as standard sequencing that is the most common service.
CES is used in a wide range of fields such as a basic research in molecular biology, breeding research, genetic disease research, paternity confirmation and forensic research, and has become a key in the continued development of life sciences.
Separate online order system is also available for customers’ convenience so that they can request a desired service.
Monitoring of all processes and follow-up for the results are provided for each ordered sample.
Sequencing Service
Standard sequencing is a service that sequences PCR products and plasmid DNA requested by customers.
Macrogen provides quicker and more accurate services based on the Capillary Electrophoresis Sequencing (CES)
automation system and extensive experience.
After the results are delivered, an expert in the sequencing field is ready to provide help until the follow-up.
-
- ABI 3730xl System
- High quality results, Normal read length (1,050bp)
- Real-time monitoring is possible from order receipt to delivery of the results based on Laboratory Information
Management System (LIMS)
- Results provided within 48 hours of sample receipt
- Free basic analysis service provided (homology search using BlastN and DNA sequence orders)
- Free universal primer
Standard Sequencing
- Standard-seq single
-
This service prepares Plasmid or PCR product as the most common single primer extension service and performs
basic sequence analysis in the section using the primer designated by the customer. -
· Service to prepare and request samples in the Individual Tube
· Complimentary one-time response service
- Additional Service
-
· PCR product Purification Single/Plate
· PCR product Gel extraction
· Gradient PCR(Customer primer set)
· PCR amplification + purification
· Customized PCR amplification + purification (Not standard condition)
· gDNA preparation
Standard Sequencing Single / Plate
Standard sequencing can be performed with single tubes and 96-well plates.
- Single Tube Sequencing
-
· Samples are prepared in individual tubes upon request
· Free re-sequencing if there is room for improvement - 96-well Plate Sequencing
-
· Samples are prepared in 96-well plates upon request
· Up to 6 types of primer can be used for 1 plate
· Free re-sequencing is not included - Additional Service
-
· PCR product purification (both single tube/plate available)
· Gel extraction
Difficult Sequencing
In PCR product and Plasmid samples, it may be difficult to verify the sequence result as the basic experimental condition.
This service is designed to check for improved sequencing results using non-normal structures and appropriate reagents and conditions.
- Features
-
· siRNA with hairpin structure
· Unusual secondary structure
· GC rich
· Homopolymeric tracts(poly G),
· GT ‒ Repetitive region -
Before
After
Primer Walking
Primer walking is a service that analyzes the sequence of plasmids or PCR products that cannot be read at once by single primer extension.
It is generally used to obtain about 2 to 10kb of sequence information.
End sequencing is performed with a primer provided or specified by the customer, and the internal primer is designed and produced based on the results.
This is extended continuously by redesigning the internal primer in a suitable location from the results obtained
by the new primer’s reaction with the same template. Walking takes about 4 days, and can be extended about 500 ‒ 800 bp in one direction.
EZ-Seq
EZ-seq brings easiness and simplicity to your daily DNA sequencing process,
in which you order barcode online, receive them by courier service and use them for sequencing.
All you need to do is to mix the template with the sequencing primer and ship the samples to our laboratory with the EZ-seq barcode labels attached.
Customized Sequencing
We have been dedicating to provide genomic solutions to researchers in all over the world with its advanced DNA sequencing technology by using ABI 3730XLs. Thanks to over 20 years long know-how and large genomics facility, we are able to provide our sequencing service from small scale sequencing reactions to large sequencing projects, we are ready to serve you with our pleasure.
PCR & Sequencing
Send us your gDNA and primers. After checking your sample quality, our R&D specialist team will proceed with
PCR amplification, PCR product purification and sequencing with the most optimum condition.
- Customized PCR
-
Customized PCR is applicable for complicated PCR conditions including Touchdown PCR amplification or nested PCR amplification.
And it is also suitable for samples like FFPE or cancer samples that require special treatment. - Gradient PCR
-
In PCR amplification step it is essential to find optimal annealing temperature in order to obtain PCR products of accurate size.
This can be done through Gradient PCR amplification by testing primers at all temperatures from 48℃ to 68℃. - Additional Service
-
· gDNA extraction (Blood, Tissue, Plant, FFPE, etc..)
· Primer design
· Gradient PCR
· SNP analysis
· Oligo synthesis
SNP & Mutation Analysis
If you select a gene part of your choice and send us a sample, we will provide you with the entire testing process
from genomic DNA extraction to sequence analysis.
We provide services to analyze genetic differences in Genome, such as SNP and Mutation,
through base sequence analysis using Macrogen’s Sanger sequencing method.
- Features
-
· SNP(Single Nucleotide Polymorphism) Discovery Analysis
· Point mutation, in/del mutation, assemble data analysis
· Target gene exon sequencing
· NGS Data validation
One click sanger Sequencing
One-click Sanger sequencing is a method of conveniently and quickly analyzing certain commonly studied
gene variations with just one click. Optimized results from gDNA extraction to PCR amplification,
sequencing and SNP analysis are delivered to customers.
Macrogen’s expert researchers perform sequencing of specific exon areas
and provide variant analysis results using a primer set manufactured based on many years of know-how.
- Features
-
· SNP(Single Nucleotide Polymorphism) Discovery Analysis
· Point mutation, in/del mutation, assemble data analysis
· Target gene exon sequencing
· NGS Data validation
NGS Validation
NGS Next Generation Sequencing (NGS) validation is a service that verifies data using Sanger sequencing
to improve the accuracy and reliability of data after using the NGS service.
When the customer specifies the chromosome position or reference sequence,
we analyze SNP of a certain area and the mutation results..
- Features
-
· Quicker and more accurate tests are possible for customers using Macrogen’s NGS service because the samples are transferred directly.
· When the chromosome position and reference sequence are verified, convenient use is possible via the one-stop service
from overall primer design to verification of sequencing results and comparative analysis of variants.
· Comparative data under normal control can be verified if required and data can also be verified using two primer sets to deliver more accurate results
PCR Optimization
PCR optimization is a customized service that performs and analyzes the entire process from primer design to PCR amplification,
sequencing and BI report when the customer provides references together with cell/gDNA in relation to the desired target region.
If the retest rate is high due to the rarity of the sample in PCR amplification, touchdown PCR amplification,
nested PCR amplification and FFPE PCR amplification, Macrogen solves the problem by using its customized PCR amplification service.
- Features
-
· Customized service
· Execution of pre-tests to provide high-quality results
· Accurate results and quick delivery and control of results by professional research staff
· gDNA can be extracted from samples of plants and animals
Identification
16S/18S/26S rRNA and ITS region full sequencing is a service that analyzes sequences
by amplifying ribosomal RNA genes of bacteria and fungi (filamentous fungus and yeast)
and confirming homology of target microorganisms using an rRNA database (NCBI).
Macrogen controls and performs all processes from gDNA extraction of bacteria
and fungi (filamentous fungus and yeast) to PCR amplification, purification, sequencing, and BI report.
Bacteria
For bacteria, PCR of 16S rRNA genes is performed using 27F and 1492R primers, and sequencing is conducted using 785F
and 907R primers, which are the inter-primers, to identify bacteria. If the customer requests,
a primer can be additionally selected/changed and about 1,350 bp or longer sequences can be provided.
The default 2rxn (785F, 907R) is selected to allow more primer runs if desired.
Fungi
1,600 bp or higher results are guaranteed by the sequencing of the 18S rRNA region.
500 bp or longer results are guaranteed by the sequencing of ITS region.
1,300bp or longer results are guaranteed by the sequencing of 26S rRNA gene (D1/D2/D3 region).
Rapid ID
Microbial mass analysis and identification service using MALDI-TOF protein analysis technology uses
the world's first FDA Clearance acquisition and AOAC certified system.
This service is suitable for customers who want accurate microbial coordination
while taking shorter time than the existing basic sequence compassion service.
- Features
-
· Report can be sent out at 10:00 a.m. (Only on receipt before 1:00 p.m. on that day)
· Optional Service Type (TAT 0, 1, 3) and amount difference by type
· Align Peaks with its own Adaptive Bining technology
· First FDA Clearance Microbiological Coordination Accuracy Acquisition and Accreditation of AOAC Validation, a U.S. certification authority.
MLST Analysis
To classify subspecies within the same species, such as Bacteria and Fungi,
the PCR amplification is conducted using 6 to 8 housekeeping genes that are homogenous.
The association between sequence types (STs) can be analyzed through data assemble by sequencing 450 to 600bp internal structure
to reveal genetic and molecular evolutionary relationships through a combination of various antagonists of different subspecies
within the same species.
Fragment Analysis
The fragment analysis service includes various services such as genotyping, DNA profiling,
medical mutation detection and agricultural research.
Macrogen provides a microsatellite analysis (VNTRs) service based on
our extensive experience and expertise.
Fragment Analysis(Genescan)
Fragment analysis is a service that separates and analyzes amplified PCR products according
to fragments using a primer marked by a fluorescent label.
- Service Types
-
· Microsatellite instability
· Amplified fragment length polymorphism (AFLP) Analysis
· Terminal restriction fragment length polymorphism (T-RFLP) Analysis
· Relative fluorescent quantization - Loss of heterozygosity (LOH), Aneuploidy assays, and Large chromosomal deletion detection
· Sequence-related amplified polymorphism (SRAP)
- Features
-
· The resulting data is provided as an FSA file (PDF and Excel files are also possible)
· Results are provided within 3 to 7 business days after samples arrive
· Customized service from PCR optimization to fragment analysis is available
- Standard Marker Types
-
Dye Set DS-30 DS-33 Blue 6-FAM 6-FAM Sample
Labeling DyesGreen HEX VIC Yellow NED NED Internal Standard
Size Marker
(Maximum detection size)- PET 350 ROX (350bp) 120 LIZ (120bp) 400HD(400bp) 500 LIZ(500bp) - 600 LIZ(600bp) - 1,200 LIZ(1,200bp)
myPETGENE ID
myPETGENE provides genetic testing services for companion animals. The genetic testing service of myPETGENE can predict their genetic diseases early and prevent them with customized control, such as improvement in eating habits and exercise. DNA can be used to identify the individual animal and prove blood ties, preventing their loss and abandonment and helping the breeding of healthy companion animals.
In some countries, it is already common to obtain the identification of an individual animal and certification for
genetic diseases with genetic testing and a culture of breeding healthy animals is established.
myPETGENE regards your companion animals as precious family members. We promise to provide more accurate and superior genetic testing services to seek a healthier life for companion animalsand establish
a proper culture for companion animals.
Human ID(Cell Line Identification)
Human ID provides a personal gene identification service upon research.
Human ID offers a paternity test that can confirm lineal ascendant relationships with a comparative analysis of the unique DNA patterns of individuals,
a maternity test that can prove the maternal blood relationships of a female,
DNA analysis of human remains for the identification of a person killed in a war,
and personal identification testing.
Human ID can perform gene analysis tests with various specimens that can be tested such as hair, epithelium cells,
body remains, and saliva, providing reliable services with 99.99% accurate test results.
Avian Sex Determination
Animal/Plant Identification is a service that identifies a species of living organism by sequencing “DNA Barcode,”
which is a region used for the identification of species in the gene of a living organism.
If you send us a sample, then we will process it from the extraction of gDNA
to the sequencing result of the barcode area and provide the analysis report.
- Features
-
-
· A species can be distinguished by just a small part of a living organism such as a leaf of a plant, a tissue of an animal,
a feather of a bird or a leg of an insect. - · A barcode can be identified even for animals that are hard to distinguish morphologically
or regardless of the development stage of a living organism because it always has the same information. -
· Identification can be made by comparison to the existing biospecies data using a standardized barcode technique,
and estimation of new species and identification of non-registered species are possible. -
· Can be used for identification of biological resource species, verification of biological resources,
verification of raw material, and verification of biological contamination. - · Customized service is available for certain standard genes or specific samples.
-
· A species can be distinguished by just a small part of a living organism such as a leaf of a plant, a tissue of an animal,
| Division | Sample Type | Genes to Analyze | Additional Analysis |
|---|---|---|---|
| Animal Barcoding | Animals, Insects, Birds, Fish, Etc | COI | 12S/16S rRNA, ITS |
| Plant Barcoding | Plants | matK, rbcL | rpoB, rpoC1, atpF-atpH, psbK-psbI. psbA-trnH |
Sample and Primer Preperation Guide (for 1 reaction)
| Template / Service | Sample Quantity | Primer Quantity | Remarks | ||
|---|---|---|---|---|---|
| PCR product Purified / Unpurified |
< 200bp | 3~5ng/ul | Minimum 10ul +5ul per reaction |
Minimum 10ul + 5ul per reaction * 5 ~ 10pmole/ul Primer TM : 50 ~ 58°C |
|
| 200~600bp | 5~10ng/ul | ||||
| 600~1000bp | 10~20ng/ul | ||||
| > 1000bp | 20~50ng/ul | ||||
| Plasmid | 100~150ng/ul | ||||
| Gel extraction | 50~100ng/ul | > 30ul | |||
| Primer Walking | 100~150ng/ul | 10~15ul per 1kb | 1-1.5ug / kb (for an insert size of up to 4kb) |
||
| 16S/18S/26S rRNA & ITS region full Sequencing (gDNA) |
30~50ng/ul | 50ul | * Agar Plates: Petri dishes * Glycerol Stocks: 1.5ml tubes. |
||
| PCR amplification (gDNA) | > 50ng | > 20ul | 20ul (10pmol/ul) | ||
- Sample for individual tube
-
· General glycerol stock/ Agar-stab/Agar-plate culture at room temperature.
· 1.5mL Microcentrifuge Tube is recommended in a lyophilized form or solution(Nuclease-free TE or distilled water) at room temperature.
- Sample for 96-well Plate
-
· 8 strip cap is recommended in a lyophilized form or solution (Nuclease-free TE or distilled water) at room temperature.
· Use an out-skirted plate to avoid any physical damage.
· Seal the plate tightly to avoid damage or contamination in transit.
· Prepare samples of concentration and size in equal among wells.
- Primer
-
· Primer : 5 pmol/ul(5uM) in 20ul based on 5 reactions.
· Primer Tm is suitable for service: 50°C ~ 58°C.
· Commonly used Universal primers are available for free of charge. (Ex. M13F, T7, T3)
Print FedEx & DHL Label & Commercial Invoice & Letter of Acceptance
We provide the shipping protocol to make all users of Macrogen’s life easier!
Air waybills and commercial invoices will be provided to you in a few clicks through this protocol.
As your account carries all of your shipping information, sender information will be automatically submitted to you.
You can also save up to three different addresses for your future orders.
You are able to print the waybill, the commercial invoice and the letter of acceptance with all shipping details already entered according to the waybill information when you click the Continue button.
When all three steps have been completed, call your local FedEx or DHL to request for pickup!
Don’t worried about the safe arrival of your samples after dispatching,
we have the monitoring system for the packages that you send us to promptly resolve all the problems happened during shipping.
Macrogen Policy for Re-sequencing
The purpose of the re-sequencing of the Macrogen Sequencing Service is to verify the machine’s error or non-treatable operability,
and only once for those things that are deemed to be possible for improvement.
Trouble Shooting Guide
No Signal
- Pattern
-
· Peaks are irregular and may appear as if it is just mixed peaks. However, such peaks are actually not normal peaks but just noise signal.
· The signal strength is less than 500.
- Cause
-
· The concentration of DNA is too low.
· The concentration of primer is too low or Tm is inappropriate for the sequencing reaction.
· The primer binding site is not on the sequence of sample DNA.
- Action
-
-
·To get fine sequencing result, the sample concentration is required as below;
- Plasmid DNA (high copy number) ; 100-150 ng/ul
- PCR product ; 25-50 ng/ul
- When you check the sample concentration by gel electrophoresis, the band should be present on a gel
if you load a sample on 1% agarose gel using 1ul of the sample. - ·Provide the primer at 5 pmole/ul or 10pmole/ul.
- ·The annealing temperature for sequencing reaction is 50℃(fixed) so Tm is recommended around 55-60℃.
- ·Check whether the primer binding site exists on the sequence of sample DNA.
- ·In case of plasmid, compare the sequence between the sequencing primer and the vector to confirm whether the primer binding site exists.
-
·Especially for primer M13R and M13R-pUC(-40), there is a difference between vector providers for primer names,
so it is required to check the sequence all the time whether the primer´s sequence is on the sequence of the sample.
- Primer M13R ; GCGGATAACAATTTCACACAGG
- Primer M13R-pUC(-40) ; CAGGAAACAGCTATGAC
* The primer binding site might be damaged. We would like to recommend that you try to use an alternative primer.
-
·To get fine sequencing result, the sample concentration is required as below;
No Signal
Mixed Template
- Pattern
-
- ·In case of plasmid, multiple peaks appear from the beginning of insertion position although clear peaks are shown up to vector position.
-
·In case of PCR product, the following aspects appear depending on what kind of non-specific PCR product is.
- - If the mixed non-specific PCR product has a similar size with the expected PCR product ;
The mixed peaks are present from the beginning to the end. In case two PCR products have similar sizes, it can be shown as if it is a single band on an agarose gel. - -If the mixed non-specific PCR product is with Insertion or deletion;
Sequence becomes mixed at position of Insertion or deletion although clean peaks are present in the beginning.
For most cases, such non-specific PCR product is longer or shorter just several bases than the expected PCR product,
this also can be shown as if it is single band on a agarose gel.
- - If the mixed non-specific PCR product has a similar size with the expected PCR product ;
- Cause
-
· This is because two colons were picked at the same time during Plasmid DNA preparation.
· This is because PCR products contain non-specific PCR products.
- Action
- · Preparing a new DNA sample is recommended.
Mixed template_2plasmids
Mixed template_2PCR products
Mixed template_general case
Compression
- Pattern
- · Multiple peaks appear from a certain point.
- Cause
-
-
·Compression occurs due to DNA fragments of different sizes with the same electrophoretic mobility.
This phenomenon is thought to be caused by regions of secondary structure within the template DNA
and as different peaks are detected simultaneously it appears as multi-peaks and although it rarely happens,
but it can be found in the regions with a high G/C or high A/T content.
-
·Compression occurs due to DNA fragments of different sizes with the same electrophoretic mobility.
- Action
- · Confirm whether the result is improved by using the opposite direction primer.
Compression
Multiple Binding
- Pattern
- · Multiple peaks appear at a different position with good signal strength.
- Cause
-
- ·If accidentally more than 2 regions have homology for the primer binding sequence the primer has multiple bindings although the template is one.
-
·When more than 2 different templates are mixed this phenomenon appears.
When 2 PCR products with similar sizes are mixed, it looks like a single band on the agarose gel..
- Action
-
· Design a long primer or design a new primer being able to avoid multiple binding.
· The use of an opposite direction primer can be helpful.
· If more than 2 similar sized products are mixed, redo PCR in a more optimized PCR.
Multiple Binding
Slippage
- Pattern
- · The phenomenon that mixed peaks appear in the back position of a long homopolymer region.
- Cause
- · Pairing occurs incorrectly in homopolymer region during polymerization.
- Action
-
· Try sequencing in both directions. For example, if a slippage pattern appears when the reverse primer is used, try sequencing toward the forward direction.
· Perform sequencing by designing a new primer avoiding homopolymer region.
Slippage
Mixed base
- Pattern
- · Partly 1 base peak appears as a double peak in the normal sequencing data.
- Cause
- · It can be caused by SNP or rarely point mutation.
- Action
- · Compare the reaction results after several runnings if base calling is suspected.
Mixed base
N-1 Primer
- Pattern
-
· Small peaks appear on the whole as like background.
· Lower peaks from the base which is the same as the major peaks are shown right before major peaks.
- Cause
-
· Primer purification was not done properly during synthesis processes.
· The primer was degraded.
· The primer binding site in the sample is not appropriate.
- Action
-
· Mostly, this phenomenon is caused by primer purification or degradation. The clear results can be obtained by sequencing with the primer resynthesized.
· Degradation can be confirmed by Macrogen MALDI (Matrix-assisted laser desorption/ionization) and Macrogen offers the service.
(When employing oligonucleotides prepared 6 months or around 1 year ago check whether the degradation occurs
before use or use oligonucleotides newly synthesized.
N-1 Primer(Before the improvement)
N-1 Primer(After the improvement)
Frameshift Mutation
- Pattern
-
· Minor peaks, the same as N-1 primer pattern appears from a certain point
· The difference from N-1 primer is whereas N-1 peak appears from right after primer binding in case of N-1 primer it appears
from the middle point in case of Frameshift Mutation.
- Cause
- · Several products are made in a sample because one or more than one base is inserted or deleted in a template.
- Action
- · Sample DNA should be newly prepared.
Frameshift Mutation
Repeat Sequencing
- Pattern
- · It is the phenomenon that the peaks in back portion are overlapped due to the repetitive sequence (the repetition of 2 or more bases is shown).
- Cause
- · It is thought that polymerase processing is interfered by repetitive sequence or the secondary structure is formed.
- Action
-
· Use the Difficult sequencing service of Macrogen.
Difficult sequencing service of Macrogen is specialized for the case of signal decrease or sudden signal loss caused by unusual secondary structure or high GC sequence.
Repeat Sequencing
Abrupt Signal loss
- Pattern
- · Peaks are suddenly stopped or rapidly lower. Whereafter data are not gained.
- Cause
- There is secondary structure existed in the sample.
- Action
-
· Perform sequencing toward the opposite direction of the corresponding result.
· Use the Difficult sequencing service of Macrogen. Difficult sequencing service of Macrogen is specialized for signal decrease or sudden signal loss caused
by unusual secondary structure or high GC sequence.
Abrupt signal loss(Before the improvement)
Abrupt signal loss(After the improvement)
Dye Blob
- Pattern
- · One or more peaks appear as wider and over-intensified peaks, commonly between 50 and 140.
- Cause
-
· This phenomenon can be shown when the sample volume is not used properly, based on the sample concentration.
· Very small quantity of BigDye left in the clean up process appears as large dye blob peaks.
· A small amount of Big Dye remains in the Clean-up process and appears as a large dye blob peaks.
- Action
- · Reduce the error as measuring the sample concentration by a gel electrophoresis and spectrophotometer.
Dye Blob