Close

Find

Close

change password

Current password
New password
Confirm new password
Close

Batch Change툴팁
You can change the selected amount and purification at once.

Amount*
Purification*
Close

Make a new group

Normal Barcode

Close

Terms of Order

Macrogen, Inc. provides service or product in accordance with the following terms and conditions (the "Terms") at the client's request.

1. Purpose

The purpose of the Terms is to establish the rights and obligations of Macrogen and Client with respect to Macrogen's service or product as requested or ordered by Client. Macrogen and Client shall faithfully perform their duties as specified in these Terms.

2. Definition

Unless specified otherwise in these Terms, the following terms have the meanings set forth herein.

  1. "Client" is a company or a person who orders service or product, and "Macrogen" is the provider of the service or product to Client.
  2. "Result" means the result of an analysis ordered by Client.
  3. "Product" means goods that Macrogen provides as ordered by Client and includes product or products.
  4. "Service" means doing work for Client by Macrogen as ordered and includes service or services.
  5. "Completion date" means the date on which Client pays an invoice and Macrogen provides the result of the service or ships the product ordered by Client.
  6. “Written form” or "in writing" includes not only general written documents, but also electronic documents and other digital formats.
  7. “Business days” means Korean business days excluding Saturday, Sunday and national holiday.

3. Contents and Scope of the Terms

  1. If Client needs any additional service or product or the parties desire to make any changes to the Terms, Macrogen and Client will enter into a separate agreement to provide such additional service or product (price and payment terms will also be included) and to make changes to these Terms.
  2. The terms and conditions of the separate agreement shall take precedence over these Terms, and the agreement shall be made in the written form.

4. Term

These Terms shall become effective as of the date when Client places an order and shall remain in full force and effect till the completion date unless agreed otherwise.

5. Approval of Result and Payment

  1. Macrogen shall invoice Client on the completion date. Client shall pay for the service or product provided by Macrogen within 30 days from the invoice date.
  2. If Macrogen cannot provide any service or product due to client's circumstances, misconduct, or negligence, or the information provided by Client has any problems (such as incorrect address or email address), the date when Macrogen is ready to provide the analysis result or ship the product will be deem to be the completion date.
  3. Macrogen's invoice includes taxes which are generally imposed on sales of product or service, including VAT; provided, however, that if any additional taxes or import taxes are imposed based on the Circumstances of Client, Client shall pay those taxes.
  4. If an invoice is not paid in full within thirty (30) days from the invoice date, any balances not paid will be subject to a ten percent (10% per annum) late payment penalty unless the parties enter into a separate written agreement.
  5. Client agrees that, if Client does not pay an outstanding invoice within the due date, Macrogen may hire a collection agency to recover unpaid balances.
  6. Client shall inspect the result or product within 10 business days from the date of receipt and notify Macrogen if there is any defects or problems. If Macrogen has not given such notification within such time period, the result or product is deemed to have no defects or problems.
  7. If Client notifies Macrogen of any defects or problems of the result or product, within the aforementioned time period and the parties agree that such defects or problems needs to be fixed or that sample reanalysis or a new product needs to be provided, Macrogen shall provide reanalysis result or a new product within the time period agreed by the parties.
  8. If re-analysis of the service result or re-supply of the new product set forth in Section 5.7 is caused by Client (such as provision of defective samples), Client shall bear the additional cost.
  9. When Client orders a service or a product for which the price is not confirmed at the time of placement of the order, Macrogen shall invoice on the date on which Macrogen provides the sercice result or ships the product. If Client disputes any invoiced charges, Client shall notify Macrogen of the disputed items within five (5) business days from the invoice date. If Client does not notify Macrogen of the disputed items within such period, the invoice is deemed to be accepted by the Client.

6. Storage of Samples and Analysis Results

  1. Macrogen, based on its internal policy, stores samples and related data for the period as specified in the following table unless requested otherwise by Client.
    Service nameAnalysis sampledata
    CES3 months3 years
    OligoN/A3 years
    NGS3 months3 months
    Clinical3 months3 months
    Chip3 months3 months
  2. Macrogen will destroy the samples and related data when the period of time specified in the table above expires.
  3. Macrogen, based on its internal policy, stores the samples and related data into commonly used storage protocols with reasonable care in the relevant industry unless requested otherwise by Client.
  4. If Client needs additional storage or additional storage period, Client shall notify Macrogen in advance. if additional storage or additional storage period incurs any additional costs, Macrogen shall notify Client of the costs and other relevant conditions.
  5. If Client requests destruction of samples or data, Macrogen shall faithfully perform the destruction procedure; provided, however, that Client shall request the destruction in writing.

7. Information Security

  1. Macrogen complies with Personal Information Protection Act, Bioethics and Safety Act, and other applicable laws and regulations related to processing orders and complies with all relevant laws and regulations of the Republic of Korea in respect of the sample analysis and storage of data.
  2. If laws of other countries are applied to the analysis or storage of data, Macrogen shall comply with those laws and regulations only if Client provides relevant information or requests such compliance.

8. Faithful Performance and Mutual Cooperation

  1. Client and Macrogen shall faithfully perform their duties under these Terms.
  2. Client and Macrogen may discuss client's order from time to time and shall cooperate with each other if necessary.

9. Confidentiality

  1. Each of the Parties agrees to keep strictly secret and confidential and use Confidential Information, including information related to each party's business management, trade secrets, technology, Clients, sample providers and any other information that should reasonably be recognized as Confidential Information ("Confidential Information"), only for the purpose of processing the order pursuant to these Terms. Notwithstanding anything in the foregoing to the contrary, each party may disclose Confidential Information pursuant to any law or legal procedure, provided that each party promptly notifies the other party in writing of such demand for disclosure.
  2. Each party shall not directly or indirectly disclose Confidential Information to any third party without the prior written consent of the other party.
  3. Each party shall not disclose Confidential Information to any third party, except the minimum number of employees who need to know such Confidential Information to process the order pursuant to these Terms.
  4. The obligations specified in Sections 9.1, 9.2, and 9.3 shall not apply to any Information which, as the Receiving Party shall demonstrate, by substantial supporting documents, at the time of disclosure:
    1. is already known to the Receiving Party;
    2. is received independently by the Receiving Party from a third party free to lawfully disclose such information to the Receiving Party;
    3. is independently developed by the Receiving Party without use of the Confidential Information; or
    4. is already in the public domain or in the future becomes part of the public domain, through no breach of these Terms.
  5. The obligations set forth in this Article shall remain in effect for two (2) years after the date of termination or expiration of these Terms.

10. Termination and Indemnification

  1. Each Party shall have the right to terminate the order and claim damages
    1. if the other Party or its creditors or any other eligible party files for its liquidation, bankruptcy, reorganization, composition or dissolution, or if the other Party is unable to pay any kind of debts as they become due, or the creditors of the other Party have taken over its management;
    2. if either party violates these Terms intentionally or by gross negligence or damages or destroys the other party or any third party's fame or property;
    3. if either party suspends performance of these Terms without good cause or interferes with the processing of the order;
    4. if the order cannot be processed due to natural disasters, economic circumstances, sudden changes in financial conditions, or other reasons for the event of force majeure; or
    5. if, during the period of these terms, either party does not cooperate with the other party to accomplish the purpose of these Terms or it is reasonably considered to be difficult to expect such cooperation.
  2. If either party makes any material breach of any terms or conditions of these Terms and fails to cure such breach within ten (10) business days after receiving written notice to cure from the other party, the other party may terminate the order pursuant to these terms.
  3. If the order is terminated pursuant to this Article, the party caused the termination shall indemnify the other party from all damages, costs, liabilities and expenses arising out of or resulting from the termination. Termination of Order does not mean an exemption from the liability for damages unless agreed otherwise.
  4. Other than the termination of these Terms pursuant to this Article, if either party has incurred damages to the other party in violation of any terms or conditions of these Terms, the party caused damages shall indemnify the other party from all such damages; provided, however, that Macrogen's Indemnifiable Costs will not exceed the total amount paid by Client for each order.

11. Technical Support and Consulting Service

After placing an order, Client may request and receive additional technical support or consulting service from Macrogen. In the event that such support or service incur any additional costs, Macrogen shall notify and discuss with the client in advance.

12. Dispute Resolution

  1. These Terms shall be governed by and construed in accordance with the laws of the Republic of Korea.
  2. Any disputes arising out of or in connection with these Terms shall be finally settled by arbitration in accordance with the International Arbitration Rules of the Korean Commercial Arbitration Board. The place of arbitration will be Seoul, Republic of Korea. The award rendered by the arbitrator(s) shall be final and binding upon the parties concerned.

13. General

  1. Client agrees that these Terms apply to all service and product orders by Client through Macrogen's Online Ordering System; Provided, however, if Macrogen and Client enter into any separate agreement, the agreement takes precedence over these Terms.
  2. Client has read and understood the main contents of these Terms and Conditions prior to placing an order and agrees that these Terms will apply to the order.
  3. When there is any changes to these Terms, Macrogen will notify Client of such changes through email or Macrogen's website. Revised Terms and Conditions will be applied to the orders placed after the effective date of those Terms.
  4. If any Client disputes any part of the revised Terms, the Client shall notify Macrogen, and Macrogen shall take necessary measures (such as deleting the Client's account) to prevent the revised Terms from being applied to the Client.

CES

CES

Capillary Electrophoresis Sequencing (CES) is a service that analyzes DNA sequences using a biochemical method.
The CES service of Macrogen maximizes customer satisfaction with various service lineups such as identification services, which involves the differentiation and identification of species of living organisms, fragment analysis services, and customized sequencing services newly applied from the existing sequencing method, as well as standard sequencing that is the most common service.

CES is used in a wide range of fields such as a basic research in molecular biology, breeding research, genetic disease research, paternity confirmation and forensic research, and has become a key in the continued development of life sciences.

Separate online order system is also available for customers’ convenience so that they can request a desired service.
Monitoring of all processes and follow-up for the results are provided for each ordered sample.

Sequencing Service

Standard sequencing is a service that sequences PCR products and plasmid DNA requested by customers.
Macrogen provides quicker and more accurate services based on the Capillary Electrophoresis Sequencing (CES)
automation system and extensive experience.
After the results are delivered, an expert in the sequencing field is ready to provide help until the follow-up.

- ABI 3730xl System
- High quality results, Normal read length (1,050bp)
- Real-time monitoring is possible from order receipt to delivery of the results based on Laboratory Information
   Management System (LIMS)
- Results provided within 48 hours of sample receipt
- Free basic analysis service provided (homology search using BlastN and DNA sequence orders)
- Free universal primer

Standard Sequencing

Standard-seq single
This service prepares Plasmid or PCR product as the most common single primer extension service and performs
basic sequence analysis in the section using the primer designated by the customer.
· Service to prepare and request samples in the Individual Tube
· Complimentary one-time response service
Additional Service
· PCR product Purification Single/Plate
· PCR product Gel extraction
· Gradient PCR(Customer primer set)
· PCR amplification + purification
· Customized PCR amplification + purification (Not standard condition)
· gDNA preparation

Standard Sequencing Single / Plate

Standard sequencing can be performed with single tubes and 96-well plates.

Single Tube Sequencing
· Samples are prepared in individual tubes upon request
· Free re-sequencing if there is room for improvement
96-well Plate Sequencing
· Samples are prepared in 96-well plates upon request
· Up to 6 types of primer can be used for 1 plate
· Free re-sequencing is not included
Additional Service
· PCR product purification (both single tube/plate available)
· Gel extraction

Difficult Sequencing

In PCR product and Plasmid samples, it may be difficult to verify the sequence result as the basic experimental condition.
This service is designed to check for improved sequencing results using non-normal structures and appropriate reagents and conditions.

Features
· siRNA with hairpin structure
· Unusual secondary structure
· GC rich
· Homopolymeric tracts(poly G),
· GT ‒ Repetitive region

Before

After

Primer Walking

Primer walking is a service that analyzes the sequence of plasmids or PCR products that cannot be read at once by single primer extension.

It is generally used to obtain about 2 to 10kb of sequence information.
End sequencing is performed with a primer provided or specified by the customer, and the internal primer is designed and produced based on the results.

This is extended continuously by redesigning the internal primer in a suitable location from the results obtained
by the new primer’s reaction with the same template. Walking takes about 4 days, and can be extended about 500 ‒ 800 bp in one direction.

EZ-Seq

EZ-seq brings easiness and simplicity to your daily DNA sequencing process. EZ-seq is a prepaid barcode service,
in which you order barcode online, receive them by courier service and use them for sequencing.

EZ-seq reduces the workload of placing orders and also the number of invoices as you will get one invoice for all barcodes.
All you need to do is to mix the template with the sequencing primer and ship the samples to our laboratory with the EZ-seq barcode labels attached.

Customized Sequencing

We have been dedicating to provide genomic solutions to researchers in all over the world with its advanced DNA sequencing technology by using ABI 3730XLs. Thanks to over 20 years long know-how and large genomics facility, we are able to provide our sequencing service from small scale sequencing reactions to large sequencing projects, we are ready to serve you with our pleasure.

PCR & Sequencing

Send us your gDNA and primers. After checking your sample quality, our R&D specialist team will proceed with
PCR amplification, PCR product purification and sequencing with the most optimum condition.

Customized PCR
Customized PCR is applicable for complicated PCR conditions including Touchdown PCR amplification or nested PCR amplification.
And it is also suitable for samples like FFPE or cancer samples that require special treatment.
Gradient PCR
In PCR amplification step it is essential to find optimal annealing temperature in order to obtain PCR products of accurate size.
This can be done through Gradient PCR amplification by testing primers at all temperatures from 48℃ to 68℃.
Additional Service
· gDNA extraction (Blood, Tissue, Plant, FFPE, etc..)
· Primer design
· Gradient PCR
· SNP analysis
· Oligo synthesis

SNP & Mutation Analysis

If you select a gene part of your choice and send us a sample, we will provide you with the entire testing process
from genomic DNA extraction to sequence analysis.

We provide services to analyze genetic differences in Genome, such as SNP and Mutation,
through base sequence analysis using Macrogen’s Sanger sequencing method.

Features
· SNP(Single Nucleotide Polymorphism) Discovery Analysis
· Point mutation, in/del mutation, assemble data analysis
· Target gene exon sequencing
· NGS Data validation

One click sanger Sequencing

One-click Sanger sequencing is a method of conveniently and quickly analyzing certain commonly studied
gene variations with just one click. Optimized results from gDNA extraction to PCR amplification,
sequencing and SNP analysis are delivered to customers.

Macrogen’s expert researchers perform sequencing of specific exon areas
and provide variant analysis results using a primer set manufactured based on many years of know-how.

Features
· SNP(Single Nucleotide Polymorphism) Discovery Analysis
· Point mutation, in/del mutation, assemble data analysis
· Target gene exon sequencing
· NGS Data validation

NGS Validation

NGS Next Generation Sequencing (NGS) validation is a service that verifies data using Sanger sequencing
to improve the accuracy and reliability of data after using the NGS service.
When the customer specifies the chromosome position or reference sequence,
we analyze SNP of a certain area and the mutation results..

Features
· Quicker and more accurate tests are possible for customers using Macrogen’s NGS service because the samples are transferred directly.
· When the chromosome position and reference sequence are verified, convenient use is possible via the one-stop service
    from overall primer design to verification of sequencing results and comparative analysis of variants.
· Comparative data under normal control can be verified if required and data can also be verified using two primer sets to deliver more accurate results

PCR Optimization

PCR optimization is a customized service that performs and analyzes the entire process from primer design to PCR amplification,
sequencing and BI report when the customer provides references together with cell/gDNA in relation to the desired target region.

If the retest rate is high due to the rarity of the sample in PCR amplification, touchdown PCR amplification,
nested PCR amplification and FFPE PCR amplification, Macrogen solves the problem by using its customized PCR amplification service.

Features
· Customized service
· Execution of pre-tests to provide high-quality results
· Accurate results and quick delivery and control of results by professional research staff
· gDNA can be extracted from samples of plants and animals

Identification

16S/18S/26S rRNA and ITS region full sequencing is a service that analyzes sequences
by amplifying ribosomal RNA genes of bacteria and fungi (filamentous fungus and yeast)
and confirming homology of target microorganisms using an rRNA database (NCBI).

Macrogen controls and performs all processes from gDNA extraction of bacteria
and fungi (filamentous fungus and yeast) to PCR amplification, purification, sequencing, and BI report.

Bacteria

For bacteria, PCR of 16S rRNA genes is performed using 27F and 1492R primers, and sequencing is conducted using 785F
and 907R primers, which are the inter-primers, to identify bacteria. If the customer requests,
a primer can be additionally selected/changed and about 1,350 bp or longer sequences can be provided.

The default 2rxn (785F, 907R) is selected to allow more primer runs if desired.

Fungi

1,600 bp or higher results are guaranteed by the sequencing of the 18S rRNA region.
500 bp or longer results are guaranteed by the sequencing of ITS region.
1,300bp or longer results are guaranteed by the sequencing of 26S rRNA gene (D1/D2/D3 region).

Rapid ID

Microbial mass analysis and identification service using MALDI-TOF protein analysis technology uses
the world's first FDA Clearance acquisition and AOAC certified system.

This service is suitable for customers who want accurate microbial coordination
while taking shorter time than the existing basic sequence compassion service.

Features
· Report can be sent out at 10:00 a.m. (Only on receipt before 1:00 p.m. on that day)
· Optional Service Type (TAT 0, 1, 3) and amount difference by type
· Align Peaks with its own Adaptive Bining technology
· First FDA Clearance Microbiological Coordination Accuracy Acquisition and Accreditation of AOAC Validation, a U.S. certification authority.

MLST Analysis

To classify subspecies within the same species, such as Bacteria and Fungi,
the PCR amplification is conducted using 6 to 8 housekeeping genes that are homogenous.

The association between sequence types (STs) can be analyzed through data assemble by sequencing 450 to 600bp internal structure
to reveal genetic and molecular evolutionary relationships through a combination of various antagonists of different subspecies
within the same species.

Fragment Analysis

The fragment analysis service includes various services such as genotyping, DNA profiling,
medical mutation detection and agricultural research.

Macrogen provides a microsatellite analysis (VNTRs) service based on
our extensive experience and expertise.

Fragment Analysis(Genescan)

Fragment analysis is a service that separates and analyzes amplified PCR products according
to fragments using a primer marked by a fluorescent label.

Service Types
· Microsatellite instability
· Amplified fragment length polymorphism (AFLP) Analysis
· Terminal restriction fragment length polymorphism (T-RFLP) Analysis
· Relative fluorescent quantization - Loss of heterozygosity (LOH), Aneuploidy assays, and Large chromosomal deletion detection
· Sequence-related amplified polymorphism (SRAP)
Features
· The resulting data is provided as an FSA file (PDF and Excel files are also possible)
· Results are provided within 3 to 7 business days after samples arrive
· Customized service from PCR optimization to fragment analysis is available
Standard Marker Types
Dye Set DS-30 DS-33
Blue 6-FAM 6-FAM Sample
Labeling Dyes
Green HEX VIC
Yellow NED NED
Internal Standard
Size Marker

(Maximum detection size)
- PET
350 ROX (350bp) 120 LIZ (120bp)
400HD(400bp) 500 LIZ(500bp)
- 600 LIZ(600bp)
- 1,200 LIZ(1,200bp)

myPETGENE ID

myPETGENE provides genetic testing services for companion animals. The genetic testing service of myPETGENE can predict their genetic diseases early and prevent them with customized control, such as improvement in eating habits and exercise. DNA can be used to identify the individual animal and prove blood ties, preventing their loss and abandonment and helping the breeding of healthy companion animals.

In some countries, it is already common to obtain the identification of an individual animal and certification for
genetic diseases with genetic testing and a culture of breeding healthy animals is established.

myPETGENE regards your companion animals as precious family members. We promise to provide more accurate and superior genetic testing services to seek a healthier life for companion animalsand establish a proper culture for companion animals.

Human ID(Cell Line Identification)

Human ID provides a personal gene identification service upon research.
Human ID offers a paternity test that can confirm lineal ascendant relationships with a comparative analysis of the unique DNA patterns of individuals, a maternity test that can prove the maternal blood relationships of a female, DNA analysis of human remains for the identification of a person killed in a war, and personal identification testing.

Human ID can perform gene analysis tests with various specimens that can be tested such as hair, epithelium cells, body remains, and saliva, providing reliable services with 99.99% accurate test results.

Avian Sex Determination

Animal/Plant Identification is a service that identifies a species of living organism by sequencing “DNA Barcode,” which is a region used for the identification of species in the gene of a living organism.

If you send us a sample, then we will process it from the extraction of gDNA to the sequencing result of the barcode area and provide the analysis report.

Features
  • · A species can be distinguished by just a small part of a living organism such as a leaf of a plant, a tissue of an animal,
        a feather of a bird or a leg of an insect.
  • · A barcode can be identified even for animals that are hard to distinguish morphologically
        or regardless of the development stage of a living organism because it always has the same information.
  • · Identification can be made by comparison to the existing biospecies data using a standardized barcode technique,
        and estimation of new species and identification of non-registered species are possible.
  • · Can be used for identification of biological resource species, verification of biological resources,
        verification of raw material, and verification of biological contamination.
  • · Customized service is available for certain standard genes or specific samples.
Division Sample Type Genes to Analyze Additional Analysis
Animal Barcoding Animals, Insects, Birds, Fish, Etc COI 12S/16S rRNA, ITS
Plant Barcoding Plants matK, rbcL rpoB, rpoC1, atpF-atpH, psbK-psbI. psbA-trnH

PyroSequencing

Pyrosequencing is a sequencing service using pyrophosphate (PPi) generated when the polymerization of nucleotide with DNA occurs. Since there are more epigenetics studies on controlling the expression level of certain genes regardless of DNA sequence, the DNA methylation analysis service is gaining more attention.

For DNA methylation analysis, very accurate and reliable results can be expected by the pyrosequencing service.

Features
· Methylation studies
· SNP & InDel Analysis
· Used for Cancer Studies
    - Even 5% or lower allele frequencies can be found
    - Suitable for somatic Mutation Analysis
    - Di-, tri-, Tetra Allelic Mutation Analysis is available

· Validation for NGS results is available
    - Biomarker verification
    - Validation & verification of GWAS & NGS data

SNP / Indel Analysis

This service provides quantitative analysis of the low frequency alle and the thermal motion of the target position in gDNA.

Features
· Methylation studies
· SNP & InDel Analysis
· Used for Cancer Studies
    - Even 5% or lower allele frequencies can be found
    - Suitable for somatic Mutation Analysis
    - Di-, tri-, Tetra Allelic Mutation Analysis is available

CpG methylation Analysis

This service quantitatively analyzes the methylation of the target CpG position after processing gDNA bisulfate.

Features
· Methylation studies
· Validation of NGS results is possible
· Biomarker verification
· Validation & verification of GWAS & NGS data

Sample and Primer Preperation Guide (for 1 reaction)

Template / Service Concentration Sample Volume Primer Volume
+ Concentration
Remarks
Plasmid 100~200ng/ul 5ul
(Minimum 10ul)
5ul
(5pmol/ul)
PCR product (below 600bp)
Purified / Unpurified
10~30ng/ul 5ul
(Minimum 10ul)
5ul
(5pmol/ul)
5-10ng /ul per 100bp
PCR product (over 600bp)
Purified / Unpurified
30~60ng/ul 5ul
(5pmol/ul)
5-10ng /ul per 100bp
Difficult Sequencing 100ng/ul 10ul 5ul
(5pmol/ul)
Primer Walking 100~150ng/ul 10~15ul per 1kb 1-1.5ug / kb
(for an insert size of up to 4kb)
16S/18S/26S rRNA & ITS region
full Sequencing (gDNA)
30~50ng/ul 50ul * Agar Plates: Petri dishes
* Glycerol Stocks: 1.5ml tubes.
PCR amplification (gDNA) > 50ng 10ul
(Minimum 10ul)
20ul
(10pmol/ul)
Sample for individual tube
· General glycerol stock/ Agar-stab/Agar-plate culture at room temperature.
· 1.5mL Microcentrifuge Tube is recommended in a lyophilized form or solution(Nuclease-free TE or distilled water) at room temperature.
Sample for 96-well Plate
· 8 strip cap is recommended in a lyophilized form or solution (Nuclease-free TE or distilled water) at room temperature.
· Use an out-skirted plate to avoid any physical damage.
· Seal the plate tightly to avoid damage or contamination in transit.
· Prepare samples of concentration and size in equal among wells.
Primer
· Primer : 5 pmol/ul(5uM) in 20ul based on 5 reactions.
· Primer Tm is suitable for service: 50°C ~ 58°C.
· Commonly used Universal primers are available for free of charge. (Ex. M13F, T7, T3)

Print FedEx & DHL Label & Commercial Invoice & Letter of Acceptance

We provide the shipping protocol to make all users of Macrogen’s life easier!
Air waybills and commercial invoices will be provided to you in a few clicks through this protocol.

STEP 1After registering your order, the page below will show up.
STEP 2On this page, the page below will show up when you click the Print Barcode button.

As your account carries all of your shipping information, sender information will be automatically submitted to you.
You can also save up to three different addresses for your future orders.

STEP 3 You are able to print the waybill, the commercial invoice and the letter of acceptance when you click the Continue button.

You are able to print the waybill, the commercial invoice and the letter of acceptance with all shipping details already entered according to the waybill information when you click the Continue button.
When all three steps have been completed, call your local FedEx or DHL to request for pickup!

Don’t worried about the safe arrival of your samples after dispatching,
we have the monitoring system for the packages that you send us to promptly resolve all the problems happened during shipping.

Macrogen Policy for Re-sequencing

The purpose of the re-sequencing of the Macrogen Sequencing Service is to verify the machine’s error or non-treatable operability,
and only once for those things that are deemed to be possible for improvement.

Trouble Shooting Guide

No Signal

Pattern
· Peaks are irregular and may appear as if it is just mixed peaks. However, such peaks are actually not normal peaks but just noise signal.
· The signal strength is less than 500.
Cause
· The concentration of DNA is too low.
· The concentration of primer is too low or Tm is inappropriate for the sequencing reaction.
· The primer binding site is not on the sequence of sample DNA.
Action
  • ·To get fine sequencing result, the sample concentration is required as below;
    - Plasmid DNA (high copy number) ; 100-150 ng/ul
    - PCR product ; 25-50 ng/ul
    - When you check the sample concentration by gel electrophoresis, the band should be present on a gel
      if you load a sample on 1% agarose gel using 1ul of the sample.
  • ·Provide the primer at 5 pmole/ul or 10pmole/ul.
  • ·The annealing temperature for sequencing reaction is 50℃(fixed) so Tm is recommended around 55-60℃.
  • ·Check whether the primer binding site exists on the sequence of sample DNA.
  • ·In case of plasmid, compare the sequence between the sequencing primer and the vector to confirm whether the primer binding site exists.
  • ·Especially for primer M13R and M13R-pUC(-40), there is a difference between vector providers for primer names,
      so it is required to check the sequence all the time whether the primer´s sequence is on the sequence of the sample.
    - Primer M13R ; GCGGATAACAATTTCACACAGG
    - Primer M13R-pUC(-40) ; CAGGAAACAGCTATGAC

* The primer binding site might be damaged. We would like to recommend that you try to use an alternative primer.



No Signal

Mixed Template

Pattern
  • ·In case of plasmid, multiple peaks appear from the beginning of insertion position although clear peaks are shown up to vector position.
  • ·In case of PCR product, the following aspects appear depending on what kind of non-specific PCR product is.
    • - If the mixed non-specific PCR product has a similar size with the expected PCR product ;
      The mixed peaks are present from the beginning to the end. In case two PCR products have similar sizes, it can be shown as if it is a single band on an agarose gel.
    • -If the mixed non-specific PCR product is with Insertion or deletion;
      Sequence becomes mixed at position of Insertion or deletion although clean peaks are present in the beginning.
      For most cases, such non-specific PCR product is longer or shorter just several bases than the expected PCR product,
      this also can be shown as if it is single band on a agarose gel.
Cause
· This is because two colons were picked at the same time during Plasmid DNA preparation.
· This is because PCR products contain non-specific PCR products.
Action
· Preparing a new DNA sample is recommended.
Mixed template_2plasmids Mixed template_2PCR products Mixed template_general case

Compression

Pattern
· Multiple peaks appear from a certain point.
Cause
  • ·Compression occurs due to DNA fragments of different sizes with the same electrophoretic mobility.
    This phenomenon is thought to be caused by regions of secondary structure within the template DNA
    and as different peaks are detected simultaneously it appears as multi-peaks and although it rarely happens,
    but it can be found in the regions with a high G/C or high A/T content.
Action
· Confirm whether the result is improved by using the opposite direction primer.
Compression

Multiple Binding

Pattern
· Multiple peaks appear at a different position with good signal strength.
Cause
  • ·If accidentally more than 2 regions have homology for the primer binding sequence the primer has multiple bindings although the template is one.
  • ·When more than 2 different templates are mixed this phenomenon appears.
    When 2 PCR products with similar sizes are mixed, it looks like a single band on the agarose gel..
Action
· Design a long primer or design a new primer being able to avoid multiple binding.
· The use of an opposite direction primer can be helpful.
· If more than 2 similar sized products are mixed, redo PCR in a more optimized PCR.
Multiple Binding

Slippage

Pattern
· The phenomenon that mixed peaks appear in the back position of a long homopolymer region.
Cause
· Pairing occurs incorrectly in homopolymer region during polymerization.
Action
· Try sequencing in both directions. For example, if a slippage pattern appears when the reverse primer is used, try sequencing toward the forward direction.
· Perform sequencing by designing a new primer avoiding homopolymer region.
Slippage

Mixed base

Pattern
· Partly 1 base peak appears as a double peak in the normal sequencing data.
Cause
· It can be caused by SNP or rarely point mutation.
Action
· Compare the reaction results after several runnings if base calling is suspected.
Mixed base

N-1 Primer

Pattern
· Small peaks appear on the whole as like background.
· Lower peaks from the base which is the same as the major peaks are shown right before major peaks.
Cause
· Primer purification was not done properly during synthesis processes.
· The primer was degraded.
· The primer binding site in the sample is not appropriate.
Action
· Mostly, this phenomenon is caused by primer purification or degradation. The clear results can be obtained by sequencing with the primer resynthesized.
· Degradation can be confirmed by Macrogen MALDI (Matrix-assisted laser desorption/ionization) and Macrogen offers the service.
   (When employing oligonucleotides prepared 6 months or around 1 year ago check whether the degradation occurs
   before use or use oligonucleotides newly synthesized.
N-1 Primer(Before the improvement) N-1 Primer(After the improvement)

Frameshift Mutation

Pattern
· Minor peaks, the same as N-1 primer pattern appears from a certain point
· The difference from N-1 primer is whereas N-1 peak appears from right after primer binding in case of N-1 primer it appears
   from the middle point in case of Frameshift Mutation.
Cause
· Several products are made in a sample because one or more than one base is inserted or deleted in a template.
Action
· Sample DNA should be newly prepared.
Frameshift Mutation

Repeat Sequencing

Pattern
· It is the phenomenon that the peaks in back portion are overlapped due to the repetitive sequence (the repetition of 2 or more bases is shown).
Cause
· It is thought that polymerase processing is interfered by repetitive sequence or the secondary structure is formed.
Action
· Use the Difficult sequencing service of Macrogen.
   Difficult sequencing service of Macrogen is specialized for the case of signal decrease or sudden signal loss caused by unusual secondary structure or high GC sequence.
Repeat Sequencing

Abrupt Signal loss

Pattern
· Peaks are suddenly stopped or rapidly lower. Whereafter data are not gained.
Cause
There is secondary structure existed in the sample.
Action
· Perform sequencing toward the opposite direction of the corresponding result.
· Use the Difficult sequencing service of Macrogen. Difficult sequencing service of Macrogen is specialized for signal decrease or sudden signal loss caused
    by unusual secondary structure or high GC sequence.
Abrupt signal loss(Before the improvement) Abrupt signal loss(After the improvement)

Dye Blob

Pattern
· One or more peaks appear as wider and over-intensified peaks, commonly between 50 and 140.
Cause
· This phenomenon can be shown when the sample volume is not used properly, based on the sample concentration.
· Very small quantity of BigDye left in the clean up process appears as large dye blob peaks.
· A small amount of Big Dye remains in the Clean-up process and appears as a large dye blob peaks.
Action
· Reduce the error as measuring the sample concentration by a gel electrophoresis and spectrophotometer.
Dye Blob
Close

Universal Primer List

Primer Name Sequence Mer Vector
맨 위로
Close Site Map
닫기

뉴스레터 및 홍보/마케팅 활용 동의

'(주)마크로젠'는 (이하 '회사'는) 정보통신망 이용촉진 및 정보보호 등에 관한 법률, 개인정보보호법, 통신비밀보호법, 전기통신사업법, 등 정보통신서비스 제공자가 준수하여야 할 관련 법령상의 개인정보보호 규정을 준수하며, 회사는 개인정보처리방침을 통하여 고객님께서 제공하시는 개인 정보가 어떠한 용도와 방식으로 이용되고 있으며, 개인정보보호를 위해 어떠한 조치가 취해지고 있는지 알려드립니다.

회사는 개인정보처리방침을 개정하는 경우 웹사이트 공지사항(또는 개별공지)을 통하여 공지할 것 입니다.

1.이용하는 개인정보 항목

- 이름, 이메일 주소, 기관 명

2. 개인정보의 이용목적

회사는 수집한 개인정보를 다음의 목적을 위해 활용합니다.

- 마크로젠 관련 뉴스/이벤트 정보 제공 - 회원 대상 홍보, 마케팅 및 맞춤형 서비스 제공

3. 개인정보의 보유 및 이용기간

- 이용 목적 달성 시 까지

※ 위와 같은 개인정보 수집 이용에 대하여 동의를 거부할 권리가 있습니다. 그러나 동의를 거부할 경우 고객 문의 시 서비스가 제한될 수 있습니다.
닫기

Privacy Policy

닫기

General Terms & Conditions

This agreement is a contract between you and Macrogen Inc. and applies to Macrogen’s services usage in whole. You shall read, agree with and accept all of the terms and conditions contained in this agreement.

Article.1 General rule

1. 1. Purpose,

This agreement is to comply with the law of electric communication enterprise and an Enforcement Ordinance in Korea on the utilization stipulation and procedure of all the related service provided by Macrogen Inc.

1.2. Service,

Service defines that it furnishes DNA sequencing and other additional information through http://dna.macrogen.com to be provided by Macrogen Inc hereunder.

1.3 Effectiveness and change of the agreement,

  1. It shall come into effect on the date when Macrogen Inc. post it in public.
  2. It may be amended by any such change of important business reasons and proceeded with work as changed after all the amendments are made.

Article 2. Enrollment of a membership and Service Usage,

2.1 Eligibility and Types of accounts

  1. To be eligible for our service, you shall obtain the consent of service usage from Macrogen and make an agreement.
  2. In the event that you have the desire to create your own account and use our service, you shall provide us with your personal information in accordance with Macrogen Inc’s request
  3. In the event that Macrogen Inc. authorizes the Service Usage to you, such notice shall be considered to be received by Macrogen Inc with User ID and other related information.
  4. Macrogen Inc. does not authorize the application of our service usage in accordance with the following:
    - apply to service with name of other persons.
    - provide false, inaccurate or misleading information
    - register on purpose of a manner that is defamatory, trade libelous, unlawfully threatening or unlawfully harassing.

2.2 Service usage and limitation

  1. Macrogen Inc. can temporarily suspend the Service usage due to system inspection, change, defect, communication interruption and Force Majeure.
  2. In the event that the service usage is suspended as set forth below in clauses a), any claims of either user or third party shall be excluded.

Article 3. Liability

3.1 Macrogen Inc’s Liability

  1. Macrogen Inc. shall take a step that you can use our service immediately from the date to be registered without any failure, except for our special cases.
  2. You shall agree to receive an e-mail related to service, important notice and promotion email / letter sent by Macrogen.
  3. In the event that you escalate any claim, we will gather information from you and take a appropriate step. While it is take a few time to settle it, we will notify the reasons and schedule to you.
  4. Macrogen Inc. shall not disclose your personal information to any third party that is not directly related to the agreement and will limit to use and improve high quality service, unless the disclosure is requires by the law, regulations or orders of the governmental authorities concerned national security and safety in very exceptional case.
  5. Macrogen Inc. would not accept liability for any damage caused by natural disasters(earthquake, a war of the elements, flood, typhoon, etc).

3.2 User’s Liability

  1. You shall be liable for all the management of your own ID and Password.
  2. You shall agree to receive an e-mail related to service sent by Macrogen.
  3. You shall give the notice to Macrogen on this matters, if your ID is used on illegally purposes,
  4. You shall abide by clauses specified on the agreement and related laws.
  5. You agree to acknowledge that any data generated from Macrogen's DNA sequencing and delivered to you resulted from labour, efforts, material and assets of Macrogen and its affiliated entities, and that you shall be liable for the payments of the processed order regardless of the success or fail of the sequence data.

Article 4. Supply and usage of Service result

4.1 Supply of Service result

  1. The turnaround time define the one from the arrival of your samples to the sending of result.
  2. If the result is delayed beyond the promised date, you shall be notified in writing of the fact of delayed service.

4.2 Services Usage,

  1. Macrogen Inc. shall treat all the sample data and information provided by you confidentially and shall not disclose them to any third party without your consent, except if the disclosure is required by following purpose:
    1. provide it by anonymity for a statistical report, academic research and market investigation
    2. identity the said person to prevent use by stealth
    3. required by the laws, regulations or orders of the Governmental authorities concerned

Article 5. Effectiveness, termination and limitation

5.1 Effectiveness

  1. You shall provide your identified information as per Macrogen’s required form and make this agreement with Macrogen.
  2. Macrogen agree to register users as a member who comply with clause 5.1.a.

5.2 Termination and usage limitation

  1. You may for its convenience, terminate contract at any time. Such termination becomes effective by your e-mail notice of termination to Macrogen after identifying your personal information (Name, TEL, Institute, FAX etc)
  2. Upon receipt of the notice, you can not, except as otherwise directed by you in the notice, log in with your ID & PW and use it.
  3. Macrogen may terminate the Contract without any notice, in whole or in part, if:
    1. violate the public order and established social morals
    2. relate to criminal act
    3. intend to utilize service for damaging national interests and social public benefit.
    4. use ID and Password of other users.
    5. bring disgrace and inflict a loss on other users.
    6. register another ID in duplicate under same user.
    7. damage sound usage of service.

5.3 Cancellation procedure of usage limitation

  1. In the case of limiting service usage, Macrgoen shall notify users or representatives in writing or phone of Macrogen’s intension fixing given date and time to terminate the contract. Such termination becomes effective by KHNP's written notice of termination to Supplier.
  2. Macrogen may, for its convenience, terminate all or any part of the service at any time by urgent problem. Such termination becomes effective by Macrogen's written notice of termination to Supplier.
  3. Under the article of 4.2.1, users or representative who is notified the termination of service usage, could make a objection.
  4. In the event of resolving the suspension of service usage, Macrogen will take a appropriate action to cancel the suspension immediately.

5. 4 User’s notice management

Macrogen can delete the notice posted by users for the following without any pre-notice.

  1. injure to a persons or group’s reputation by a slander
  2. violate public order or established social morals.
  3. commit a criminal act
  4. infringe copyright against other people
  5. violate related law or Macrogen’s rule.

Article 6. Arbitration

All disputes, controversies or differences which may arise out of or in connection with the Contract or for the breach thereof shall be finally settled by arbitration in Seoul, Korea in accordance with the Commercial Arbitration Rules of the Korean Commercial Arbitration Board and the laws of Korea.

Aricle 7. Governing Law

The Contract shall be governed and interpreted by the laws of the Republic of Korea.

Article8. Liabilities and remedy

8.1 Liabilities

Unless otherwise provided herein, Supplier shall not be liable for any consequential, direct or indirect damages, related to free service , except for the damages caused by willful misconduct.
Macrogen lifetime storage service will be provided to all of our customers at free of charge up to fifteen (15) years from the date of data creation.
We are not liable for damage or losses to any of one’s standard sequencing result files which are stored in Macrogen’s server resulting from participation in or accessing or downloading file or data in connection with the Service.
We reserve the right, in our sole discretion, to cancel or suspend the Service should a virus, bugs, or other causes beyond our control corrupt the administration, security or proper operation of the Service.

8.2 Remedy

  1. Macrogen have no obligation to confirm and represent any opinion and information provided by Macrogen’ sequencing service, users and third party.
  2. Macorgen shall not be liable for any loss caused by commodity transaction or leading and borrowing money through service between users and a third party and expected profit from service.

8.3 Liquidated damage,

You shall pay liquidated damages, not as a penalty, to Macrogen in an amount of 10% of total amount of the delayed payment behind due date.

# Appendix

  1. All payment shall be made by you to the designated Macrogen’s banking account, or by the individual or corporate credit card and shall be made in the United States Dollar or Euro or Japanese Yen or British Pound.
  2. According to the general terms and conditions on above-mentioned, we would like to inform you that we will charge you the amount of the service charge as per the inserted card number unless the payment is done no later than one month after the receipt of the commercial invoice of our sequencing service.
  3. You can choose one of the payment methods among the followings.
    1. Telegraphic Transfer in advance
    2. Telegraphic Transfer at sight of the commercial invoice
    3. Payment of credit card as per your the level of the credit
    4. Banking Check
  4. Single Pass Sample Resequencing policy
    Resequencing is provided in order to verify any possibility of machine error or operator's mishandling and carried out only when
    DNA sequencing quality can be improved. Therefore, retrial request for failures owing to template preparation or composition
    will be all charged. Also, re-sending a new batch, in spite of the same sample names, will be regarded as a new order.